Автоматический cписок непереведённых объектов
Планы на перевод
»
Автоматический cписок непереведённых объектов
Предисловие: Список создан для максимально удобной навигации. Бывает такое, что, листая список англовики, натыкаешься на интересный объект, который хочешь перевести, но обнаруживаешь его на русскоязычной вики уже в процессе перевода. Кроме того, иногда очень сложно мониторить список переведённых статей на предмет пропущенных номеров.
Примечание: Все ссылки во вкладке "Объекты других филиалов" взяты c сайта International Translation Archive, который содержит не полный список оригинальных объектов. При достаточном владении иного языка разрешается переводить объект с его основного сайта.
- 001-999
- 1000-1999
- 2000-2999
- 3000-3999
- 4000-4999
- 5000-5999
- 6000-6999
- 7000-7999
- 8000-8999
- Объекты других филиалов
- Шуточные объекты
- Обоснованные объекты
Фрагмент списка для редактирования
Содержание
Корейский филиал
Китайский филиал
Французский филиал
Польский филиал
Испанский филиал
Тайский филиал
Японский филиал
Немецкий филиал
Итальянский филиал
Украинский филиал
Португальский филиал
Чешский филиал
Традиционный Китайский филиал
Вьетнамский филиал
Корейский филиал
- Codename: scka - Defense mechanism
- Codename: L.H. Sein - By people
- SCP-002-KO - Xianess' fountain
- SCP-003-KO - Farmhouse
- SCP-004-KO - Eraser Phenomenon
- SCP-005-KO - Mush-Room
- SCP-006-KO - Killer Bed
- SCP-010-KO - Honest Scam Calls
- SCP-011-KO - The Sleeping Giant
- SCP-014-KO - Ask Anything
- SCP-021-KO - The sage's book
- SCP-022-KO - The magnifying glass
- SCP-033-KO - Print Foundation Documents With Caution
- SCP-034-KO - Wolf Flower
- SCP-048-KO - Science Club
- SCP-049-KO - The Black Parade
- SCP-050-KO - About SCP-050-KO
- SCP-056-KO - ［ WARNING: DO NOT READ THIS PAGE! ］
- SCP-064-KO - Seoul Cinematic Production
- SCP-072-KO - Absolute Taste
- SCP-077-KO - The Bermuda Triangle Underwear
- SCP-079-KO - Containment-longing Shuttles
- SCP-086-KO - Knives for Vegans
- SCP-111-KO - A Small Error
- SCP-112-KO - "Dog" Soju
- SCP-113-KO - Eternal Thursday
- SCP-114-KO - LED Fen Fire Flies
- SCP-115-KO - "Meaningless" Regular Polyhedron
- SCP-118-KO - The Savior of All
- SCP-132-KO - Bawling Bamboo
- SCP-137-KO - The Bad Land
- SCP-149-KO - CC BY-NC-ND
- SCP-153-KO - Read me before read below
- SCP-154-KO - Read me before read above
- SCP-157-KO - No time to go to the toilet
- SCP-159-KO - Peach Blossom Land
- SCP-168-KO - Stir-fry?
- SCP-169-KO - The Volition Wins The Day
- SCP-171-KO - Forgotten Music
- SCP-185-KO - Visual Novel
- SCP-188-KO - Heart of the Earth
- SCP-189-KO - Dark alleyway
- SCP-212-KO - Rusty Spade
- SCP-217-KO - USS Enterprise
- SCP-222-KO - A Train in Flames
- SCP-229-KO - Quadrennial
- SCP-234-KO - Doing Dootie Duty
- SCP-268-KO - STRUCTURE ERROR
- SCP-299-KO - A Murder of Crows
- SCP-310-KO - Foods From That Far Place
- SCP-321-KO - Fade-in Virus
- SCP-326-KO - Natural reality fixation
- SCP-345-KO - The Space Hero
- SCP-380-KO - Now the test begins.
- SCP-412-KO - [DATA NOT EXPUNGED]
- SCP-416-KO - There is an instrument buried under the oak tree.
- SCP-432-KO - The Child Gifted With Immortality
- SCP-444-KO - Avici
- SCP-499-KO - The real "BGM"
- SCP-500-KO - The only cure
- SCP-503-KO - Normalcy Classification System
- SCP-505-KO - The Schoolbag
- SCP-521-KO - What is Seeing?
- SCP-545-KO - The Non-Flying Dutchman
- SCP-602-KO - I want to be myself for once
- SCP-621-KO - I will live in ██
- SCP-650-KO - The Duty to Stop All Sin and Unhappiness On This World
- SCP-689-KO - Fangi
- SCP-702-KO - Grownups Don't Know
- SCP-709-KO - Dismembered Eternity
- SCP-713-KO - Gods of the Flying House
- SCP-750-KO - Revenant Soldier
- SCP-755-KO - Learn all the technology and knowledge you want; there are Other Important Things
- SCP-774-KO - Planet Indra
- SCP-797-KO - Skyfall
- SCP-809-KO - Along the thorny vines
- SCP-817-KO - Flame of Love
- SCP-819-KO - Open the Curtains, Lights on
- SCP-824-KO - 22×6×1023 drops of water
- SCP-825-KO - Sokcho Tongkeun Mulhoe Restaurant
- SCP-826-KO - Homo Sapiens
- SCP-827-KO - It's Beginning to Smell a Lot Like Christmas Everywhere I Go
- SCP-828-KO - A Door Locked from the Inside
- SCP-829-KO - MAD man
- SCP-830-KO - 's slippers
- SCP-841-KO - Supervisor: Antimeme Expert Lee Hanseok
- SCP-876-KO - Head Siren
- SCP-877-KO - B████d B████s
- SCP-890-KO - Here be We, the Consequence of Your Actions
- SCP-897-KO - [ASMR] Dentistry / Teeth Extraction Relaxing Sound
- SCP-903-KO - Not Steroids!
- SCP-916-KO - Perfectly Replaces the Biological Patriarch
- SCP-923-KO - The Anti-Disney Department
- SCP-953-KO - Pretending Humanoid
- SCP-973-KO - Man With Gun
- SCP-980-KO - Cloudy with a Chance of People
- SCP-997-KO - The Edge of Esotery
- SCP-516-KO-EX - [DATA REDUCED]
- SCP-7891-KO-EX - Amnestic Mushroom
- SCP-001-EX-KO-J - A Bad Boy
- SCP-1004-KO-J - Girls' Magic Wand
- SCP-none-KO-J - It's an annoying clothes hanger!
Китайский филиал
- CODE NAME: Darkequation - Bamboo Scroll
- CODE NAME: Anglia - Dragon Vein
- CODE NAME: Veleafer - 演绎部
- CODE NAME: Re_spectators - Substitution Reaction
- SCP-CN-009 - Question, Solve, Answer
- SCP-CN-010 - Aye-aye
- SCP-CN-026 - No Longer be Alone
- SCP-CN-048 - A Failed Attempt
- SCP-CN-066 - OMG! What the Foundation Has Failed to Do for 20 Years Was Done by SCP-CN-066 in Just 4 Seconds…
- SCP-CN-096 - "Stop" "Door"
- SCP-CN-111 - The Solitary Venerable One
- SCP-CN-114 - Pine of Awakening Smoke
- SCP-CN-121 - The Badge of Dr. Sun Yat-sen
- SCP-CN-, 00122 - Fifthist Memetics
- SCP-CN-145 - Hometown
- SCP-CN-161 - Interpreter
- SCP-CN-166 - Embryos
- SCP-CN-171 - Dormitory Manager
- SCP-CN-176 - Uncle Sweets
- SCP-CN-180 - SPEEDCORE GENERATOR!!!
- SCP-CN-204 - Thunder Trial
- SCP-CN-233 - Dot Matrix
- 丂匚卩 句丹丂卄 匚几 句丹丂卄 丅山口 几丨几乇 丂丨乂 - 卄丹几乙丨 从乇从乇
- SCP-CN-312 - What Does She Know?
- SCP-CN-326 -
In Fading BooksA Digital Music Fantasy Is Reborn - SCP-CN-366 - Exist
- SCP-CN-369 - Self-Declaration Rostrum
- SCP-CN-404- Memetic Immunity Disease
- SCP-CN-412- Beauty Camera
- SCP-CN-440- Immortals of the Table
- SCP-CN-444 - Heavenly Sounds
- SCP-CN-445 - A Failed Anomalous Document
- SCP-CN-475 - Entombing
- SCP-CN-514 - Insomnia
- SCP-CN-529 - No Longer Human
- SCP-CN-534 - Mr. Dialect
- SCP-CN-546 - Our Secrets
- SCP-CN-661 - Dick, St. Dick
- SCP-CN-666 - Hold the Bottom Line
- SCP-CN-673 - A bunch of statues what move when you dun look at dem
- SCP-CN-675 - The Great Kyet Khaewt Device
- SCP-CN-678 - Stranger
- SCP-CN-713 - Keyboard Fish
- SCP-CN-717 - Throat Forest
- SCP-CN-731 - Black Sunset
- SCP-CN-756 - Book of Numbers
- SCP-CN-757 - Tiny World
- SCP-CN-758 - Mini-Foundation
- SCP-CN-767 - Chart Syndrome
- SCP-CN-797 - The Wandering Train
- SCP-CN-805 - Magic: The Gathering
- SCP-CN-810 - "Gold Foil"
- SCP-CN-829 - Spherical Potatoes
- SCP-CN-844 - The Seed of Lovesickness
- SCP-CN-861 - The pedestrian in a painting
- SCP-CN-879 - Programmable Office Building
- SCP-CN-918 -
Ever-DriftingPaper Plane - SCP-CN-937-J - A Useful Toilet
- SCP-CN-964 - I'll turn on the Bluetooth and listen to some tunes
- SCP-CN-985 - Exam Shark
- SCP-CN-999 - Spreading Your Wings
- SCP-CN-1000 - 2300
- SCP-CN-1001 - Writing Ends Here
- SCP-CN-1050 - "Aquarius"
- SCP-CN-1076 - "Have another bottle"
- SCP-CN-1080 - A Silent Bell
- SCP-CN-1099 -
Tin of Sardines - SCP-CN-1123 - CTTGGGAGATGAATAGATGGGTTGCAACCCATCTATT……
- SCP-CN-1138 - Anime Must Be Destroyed
- SCP-CN-1145 - A Nonexistent Elevator
- SCP-CN-1174 - Royal Quiet Deluxe Typewriter
- SCP-CN-1256 - SCP Foundation Chinese Branch Chronicle
- SCP-CN-1260 - Origin of Species, or Machinery of Creation
- SCP-CN-1276 - "Zekkōchō Conveyor Belt Sushi Restaurant!"
- SCP-CN-1391 - hamster pill by dado
- SCP-CN-1409 - 4200006200
- Work Notes: SCP-CN-1417
- SCP-CN-1424 - not spicy mouthwash by dado
- SCP-CN-1463 - Catgirl Training Plan
- SCP-CN-1483 - Those distant, cold stones
- SCP-CN-1500 - pʰoʃma
- SCP-CN-1537 - Storytelling
- SCP-CN-1604 - A Gun That Gets More Powerful As It Kills More People
- SCP-CN-1621 - become cat pill by dado
- SCP-CN-1666 - Veilbreak
- SCP-CN-1691 - A machine looking for loved ones
- SCP-CN-1733 - The Empty Patches of Sky
- SCP-CN-1767 - What is Papa's Mama Called?
- SCP-CN-1780 - Red Light, Green Light
- SCP-CN-1831 - Human-repelling Incense
- SCP-CN-1835 - The day the music died. Except for you.
- SCP-CN-1837 - USB Sword
- SCP-CN-1920 - J-Q-X, three brothers, see fish eyes and dig them out
- SCP-CN-1976 - Little Red Book
- SCP-CN-1987 - Plunger
- SCP-CN-1997 - When Magic and Science Intersect
- SCP-CN-2019 - Forbidden Borderline Θ
- SCP-CN-2035 - Terminal Entertainment!
- Riddle-2109: God
- SCP-CN-2176 - Zero-Calorie Biscuits
- SCP-CN-2200 - Hyper Dimension Action
- SCP-CN-2215 - A Literary Opinion
- SCP-CN-2227 - Drunk Alone
- SCP-CN-2270 - Rainbow Mount
- SCP-CN-2300 - 1000
- SCP-CN-2304 - The Sun is Tired of Rising
- SCP-CN-2345 - Memory-Carrying Enoki
- Observation File #CN-2380 - When Spring Comes
- SCP-CN-2399 - Still Raining
- SCP-CN-2401 - Sick Hall
- SCP-CN-2402 - The Star Nearby
- SCP-CN-2403 - Dodgeball
- SCP-CN-2405 - Ronald McDonald
- SCP-CN-2406 - … would much rather have KFC!
- SCP-CN-2426 - McNugget Fundamentalism
- SCP-CN-2440 - A video of torturing tubers
- SCP-CN-2517 - A Man Who Can
not, In Fact, Fly - SCP-CN-2620 - Birthday
- SCP-CN-2626 - D4C
- SCP-CN-2631 - Aliens Speaking English
- SCP-CN-2636 - MTF-己申-20 ("We")
- SCP-CN-2740 -
Addictive Minecraft, Sentient NPCs, Digital Lies, Longing for Reality - SCP-CN-2752 - I See the Machine Core Before the Mechanical Revolution
- SCP-CN-2781 - Before Sleeping
- SCP-CN-2806 - Slickness
- SCP-CN-2835 - Where am I?
- SCP-CN-2878 - Very Annoying Mosquitoes
- SCP-CN-2879 - Very Big Strainer
- SCP-CN-2880 - Very Sharp Sword
- SCP-CN-2918 - The Pleasant Sound of Rain
- SCP-CN-2926 - Big Prime Number
- SCP-CN-2980 - Your Copper Sulfate Friend
- SCP-CN-2987 - Don't Look Up
- SCP-CN-2989 - DEMONSTRATION OF THE PRECENCE
- SCP-CN-2991 - Why disbelieve ye in the revelations of Anormaly, when ye bear witness
- SCP-CN-116-EX - A Dazzling, Lively Relic
- SCP-CN-3300-EX - The Lamb has Died
- SCP-CN-123-J - How Many Urinals Do We Need?
- SCP-CN-213-J - The Magical Geoduck
- SCP-CN-404½-J - "The Foundation is FAKE!"
- SCP-CN-421-J - The Great Radish
- SCP-CN-555-J - Hurts Like Hell!
- SCP-CN-666-J - Mew Mew Mew
- SCP-CN-963-J - Extremely Annoying Codes
- SCP-CN-1616-J - WTF YOU SAID YOU DIDNT REVIEW
- SCP-CN-2000-J - Foundation's Bizarre Black-Technologies
- SCP-CN-2719-J - "Waifu"
Французский филиал
- CODE NAME: Dr. Gray - Not all angels have wings
- CODE NAME: Dr. Johannes - Program Xibalba
- SCP-014-FR - Agent of Chaos
- SCP-021-FR - Lights of the Cliffs
- SCP-027-FR - "Get Rick Rolled"
- SCP-031-FR - The Knowledge-Eaters
- SCP-043-FR - Blind Wanderer
- SCP-045-FR - Thieving Arthropod
- SCP-059-FR - Blizzard's Claws
- SCP-060-FR - The Lich
- SCP-061-FR - The Kiwi
- SCP-073-FR - Biological Sterilizer
- SCP-089-FR - The Athena Project
- SCP-095-FR - The Demon Core
- SCP-113-FR -
Infected fileS.O.S. - Dr. Anton Vehan - SCP-116-FR - Trabant 601 S "Hermes"
- SCP-125-FR - Mark IV
- SCP-137-FR - The One True Religion
- SCP-143-FR - Mesozoic chicken coop
- SCP-150-FR - Vox
- SCP-155-FR - Wake up
- SCP-161-FR - The Book And The Beast
- SCP-164-FR - Creationism
- SCP-172-FR - "Points of View"
- SCP-181-FR - Non-recyclable
- SCP-185-FR - Kinetic Inverter
- SCP-192-FR - Your question
- SCP-197-FR - Gardener Tortoises
- SCP-198-FR - Considerations on the Causes of the Greatness of Mankind and its Decline
- SCP-201-FR - Mind Palace Syndrome
- SCP-213-FR - The Vagabonds of the Dark Forest
- SCP-215-FR - Industrial Sardine
- SCP-218-FR - The Antiquity Manufacturer
- SCP-227-FR - Horoscomaton®
- SCP-233-FR - The Pillow That Makes You Sleep
- SCP-237-FR - Absurd Instability
- SCP-281-FR - The Day The Earth Stopped Being Flat
- SCP-291-FR - Containment Procedures Updated
- SCP-296-FR - Dusk on Mars
- SCP-299-FR - 113-B
- SCP-320-FR - Life is a pillow
- SCP-324-FR - He Died Thrice
- SCP-327-FR - Foresight Cameras
- SCP-335-FR - Lacrymodjinn
- SCP-347-FR - Risky Driving
- SCP-361-FR - Matriarch
- SCP-375-FR - Proof of the existence and uniqueness of the Self
- SCP-400-FR - She's Too Beautiful to be True
- SCP-403-FR - Güiro in Exile
- SCP-418-FR - Maurice the Concept-Eating sheep
- SCP-445-FR - Monkey See, Monkey Shoot
- SCP-466-FR - The Cottage Pottage
- SCP-471-FR - Riders on the Storm
- SCP-476-FR - Molecular Voodoo Dolls
- SCP-484-FR - Billy the Euc-kid
- SCP-503-FR - An Imperfect Allegory
- SCP-505-FR - Before Aleph
- SCP-510-FR - 5 Stars
- SCP-540-FR - The Grass is greener
- SCP-555-FR - The SCP Religion
- SCP-569-FR - Dimensional gloryhole
- SCP-589-FR - The Lamppost Song
- SCP-192-FR-J - Chicken that runs like really really fast
- FCP-676-FR-Vay - Exftremely Danverouf Viruf
- SCP-1054-FR-J - Schisms
- SCP-SKIP-FR-J - Skip For Long Optimal Multifunction Whiteness ©
Польский филиал
- CODE NAME: ZeroStrider — Wingless Birds
- SCP-PL-007 - Happily nonexistent object
- SCP-PL-023 - Written World
- SCP-PL-030 - The Mulch
- SCP-PL-037 - The Haunter
- SCP-PL-052 - Subtemporal bracer
- SCP-PL-057 - Leccinum Disappearing
- SCP-PL-066 - Trapdoor in a storeroom
- SCP-PL-067 - Dog that traveled in time
- SCP-PL-078 - Earrings of Instant Meetup
- SCP-PL-086 - I know about the Foundation
- SCP-PL-091 - Calcumuttons
- SCP-PL-144 - Analogue Virtual Reality
- SCP-PL-149 - The Cinema
- SCP-PL-150 -
On vacations - SCP-PL-152 - Pet snakes
- SCP-PL-160 - Fat Burner
- SCP-PL-166 - Cemetery lights
- SCP-PL-173 - Fungal sounds
- SCP-PL-174 - R'EALITYBLENDER™
- SCP-PL-180 - Those who embark with us
- SCP-PL-183 - Lust of Speed
- SCP-PL-186 - Art is Death
- SCP-PL-195 - Gift from a friend
- SCP-PL-200 - Responsible Reading
- SCP-PL-203 - Weather for 2033
- SCP-PL-204 - How to Disappear Completely and Never Be Found
- SCP-PL-213 - Gloria Necatis
- SCP-PL-231 - The Wrath of Perun
- SCP-PL-248 - Heraclitic Tears
- SCP-PL-253 - WHAT IN THE KENTUCKY FRIED FUCK
- SCP-PL-259 - The list of territories conquered by Genghis Khan is incomplete, you can help by expanding it
- SCP-PL-260 - We know where you live
- SCP-PL-262 - A
- SCP-PL-267 - Mieszko, Mieszko, mój koleżko
- SCP-PL-284 - Oh God, oh fuck
- SCP-PL-289 - A Multidimensional Solution For Shopping at Biedronka
- SCP-PL-290 - Empiricism
- SCP-PL-121-J - Diego the Turtle
- SCP-PL-2004-J - The very fast vehicle of anthropomorphic amphibian
- SCP-PL-2021-J - The hope for our world
- SCP-PL-6470-J - Cat meme [DANGEROUS]
Испанский филиал
- CODE NAME: Uncle Nicolini - The Nexus of Babel
- SCP-ES-038 - The Bussinesman
- SCP-ES-039 - Satellipeople
- SCP-ES-040 -
Polaris Leporidae - SCP-ES-044 - Necrofauna Arthropoda
- SCP-ES-048 - The Power of Ideas
- SCP-ES-054 - The Garden Gnome Gardeners
- SCP-ES-058 - Stilhed Overalt; Silence Everywhere
- SCP-ES-059 - Thirteen Little Fingers
- SCP-ES-069 - The Twine upon the Fate of her Appeal to Look
- SCP-ES-070 - Narcissus and the Plain of the Arrows of Eros
- SCP-ES-076 - https://www.youtube.com/watch?v=fgm14D1jHUw
- SCP-ES-081 - Gluttony
- SCP-ES-083 - deCipher'em All v1.6
- SCP-ES-087 - Sandbox; Intentional Continental Drift; I don't know biology so I'll turn fish into birds.
- SCP-ES-089 - The Last Emperor of Hoiohiña
- SCP-ES-090 -
Nine Lights Emissary - SCP-ES-091 - Eugenics Nightmare
- SCP-ES-095 - A Victimless Crime
- SCP-ES-096 - THE GALLEON, or; Hunt the Dutchman! Or; The Assfuckedship
- SCP-ES-097 - Fungi Reactor
- SCP-ES-098 - Kynodontos
- SCP-ES-099 - The Piano Concert
- SCP-ES-100 - For Your Safety, Please Use the Stairs
- SCP-ES-101 - Ye Shall Not Worship False Gods
- SCP-ES-102 - The Cage
- SCP-ES-103 - Frustrated Musician
- SCP-ES-105 - Stargazing The Other Stars
- SCP-ES-107 - Partnercaller3000
- SCP-ES-111 - An explorer fallen from somewhere else
- SCP-ES-112 - 🤑🔫 pay 2 win 🔫🤑
- SCP-ES-113 - Special Deal
- SCP-ES-115 - This is the Metro of Franco's Spain
- SCP-ES-116 - A Gossiper Gramophone
- SCP-ES-117 - A second chance
- SCP-ES-119 - The Ministry of Abnormalities of Cuba
- SCP-ES-120 - This Sickness Will Not Defeat Me
- SCP-ES-122 - greatGreenishGreenery v1.01
- SCP-ES-123 - Aurus Trading Company
- SCP-ES-125 - North Korean Orbital Bombardment System
- SCP-ES-132 - The Wall; The Selective; The Thing That Kills You; We Don't Let Fools In; The Witch Burning; The Booby Trap; Stress; These Fools Don't Learn; We Have The Key; The Key; I Need Sleep; Sometimes, A Break; Sometimes, A Life; Merlín
- SCP-ES-133 - The Green One always finds its way
- SCP-ES-136 - Penitent Cry
- SCP-ES-137 - Sadness
- SCP-ES-142 - The Bones of the Saints
- SCP-ES-143 - May the Light of St. George lead us to Victory
- SCP-ES-145 - Funerary Licentiousness
- SCP-ES-146 - Who am I?
- SCP-ES-147 - Cessation of Legacy
- SCP-ES-152 - The Fall of the Fools
- SCP-ES-157 - Coppélia
- SCP-ES-158 - And the Potatoes Took Over the Earth
- SCP-ES-163 - Elephant Graveyards
- SCP-ES-165 - Kaiju Sarcophagus
- SCP-ES-169 - The Hentai Dream Made True
- SCP-ES-173 - The last sacrifice to Vulcan
- SCP-ES-178 - The best re-union you will never have.
- SCP-ES-180 - It's not yours, it's ours
- SCP-ES-181 - The King Who Burnt
- SCP-ES-184 - Vitrified Fortresses
- SCP-ES-185 - Space Swallow
- SCP-ES-186 - Absolute Corruption of Power
- SCP-ES-191 -
Stellar Garden - SCP-ES-193 - On the 13th of April, 2013, a Train Fell From the Sky
- SCP-ES-194 - That motherfucker Fidel Castro just won't stay dead!
- SCP-ES-196 - Buried Dreamers
- SCP-ES-199 - Institution for Dealing with Your Issues of Normalcy
- SCP-ES-200 - Mind Control Ball Cactus
- SCP-ES-201 - Theatrum Mundi
- SCP-ES-202 - What is HANSARP?
- SCP-ES-203 - Super Golden Fruit
- SCP-ES-208 - Flying Pigs
- SCP-ES-216 - Lutiya, Pillar of Silence
- SCP-ES-220 - Burning Soul
- SCP-ES-230 - EAGLE Protocol
- SCP-ES-232 - Gramophone Gal (Do You Like Gramophones?)
- SCP-ES-234 - Detective Marw, Private Eye
- SCP-ES-245 - Autarchy of Atonement
- SCP-ES-250 - First Parca: Sons of the Harvest
- SCP-ES-251 - Second Parca: Tales of Misery
- SCP-ES-252 - Third Grim Reaper: The Life of Death
- SCP-ES-256 - At midnight
- SCP-ES-260 - The Blue Eyes of Gea
- SCP-ES-261 - The taste of the stars and the desolation of Juno
- SCP-ES-262 - RAVEYARD
- SCP-ES-264 - A Friendly Crab
- SCP-ES-266 - Scavenger Jellyfish
- SCP-ES-268 - Electromagnet-shrooms
- SCP-ES-284 - A, last? regret
- SCP-ES-288 - Who is that walking beside you?
- SCP-ES-290 - Wrong Taxi
- SCP-ES-296 - The Path From Which We Come From
- SCP-ES-297 - 🌮🔔
- SCP-ES-100-EX - Mother Nature
- SCP-ES-112 Extended Testing Log
- Document-ES-061-B
- SCP-RU-178 - The Heroes Of Vólorovsk
- Proposal by Nico, Who Has Gone A Little Crazy
- SCP-ES-I don't care-J - I don't care
- SCP-ES-050-h2o-J - Bears are better than crocodiles. Probably.
- SCP-ES-101-J - The Hard-To-Open Container
- Emily Miranda Sends Nudes
Тайский филиал
- CODE NAME: DrSSS - Another World Comers
- SCP-009-TH - Human Anatomy Model
- SCP-043-TH - Human Ice Cream
- SCP-072-TH - The Castle Guards
- SCP-400-TH - The Elephant is a Blood-thirsty Animal
- SCP-412-TH - The Lattice (The Hydrologic Cycle)
- SCP-747-TH - The Black Box
- SCP-901-TH - The Giant Head
- SCP-903-TH - Very Huge Dinosaur
- SCP-025-TH-J - Stop for Inspection Sign
- SCP-222-TH-J -
The Troll CatThe Genius Hacker Cat
Японский филиал
- CODE NAME: solvex - Acquittal and Miniascape
- CODE NAME: amamiel - Ave Maria
- CODE NAME: indonootoko - Arahitogami
- CODE NAME: k-cal -
The Balance ScalesThe Handover Report You Want - SCP-010-JP - "Mirai PC"
- SCP-017-JP - Local Rules
- SCP-020-JP - Winged Human
- SCP-023-JP - Shadow Railway Line
- SCP-030-JP - Petroleum Devourers
- SCP-043-JP - Seasoning that Makes Anything Edible
- SCP-047-JP - "For the Greatest Music"
- SCP-065-JP -
from today on i am the prime ministerAll We Need Is Dominator - SCP-076-JP - Terror Overhead
- SCP-082-JP - To the Desired Country
- SCP-086-JP - Zombie Virus
- SCP-088-JP - Babies Can Choose Their Moms and Dads to Be Born to
- SCP-094-JP - Marine Man
- SCP-095-JP - Satō Saitō
- What is SCP-105-JP? I've investigated it in my own way!
- SCP-115-JP - Nue
- SCP-120-JP - The World's Most Valuable Jewel
- SCP-132-JP - One Fish, Two Fish, Paper Fish, Silverfish
- SCP-167-JP - Restaurant Seashore
- SCP-181-JP - Effective Advertising
- SCP-184-JP - Worn-Out Utility Pole
- SCP-194-JP - Paradise Inside a Memory
- SCP-199-JP - Another Audience
- SCP-266-JP - A Town Without Anyone
- SCP-268-JP - The Never-Ending Epic
- SCP-272-JP - "Floora"
- SCP-277-JP - Feigning Death Tank
- SCP-333-JP - The Earthlings
- SCP-359-JP - Penguin Mushroom
- SCP-373-JP - Manufacturing Group
- SCP-398-JP - Eternal Room 105
- SCP-407-JP - A Tub
- SCP-419-JP - An Alternate History of Easter Island
- SCP-444-JP - █████[ACCESS UNAUTHORIZED]
- SCP-475-JP - I Want to See Only Beautiful Things
- SCP-496-JP - Warning: Electronic Protocol in force when viewing this document
- SCP-522-JP - Airborne Baguette Concentration Measurement Station
- SCP-534-JP - Get a Glass for Flea
- SCP-546-JP - Sugar and Spice and All That's Nice
- SCP-548-JP - Singing Rain Sounds
- SCP-557-JP - Déjà Mort
- SCP-558-JP - Bunch o' Chicks 'n' BIG MAMA
- SCP-569-JP - Konpeight
- SCP-571-JP - NIGIRI OF THE DEAD
- SCP-583-JP - Darkness of the Remembrance
- SCP-586-JP - Snow Globes Past the Sell-By Date
- SCP-588-JP - Transdimensional Buttock Wall ~ A Karcist's Ass Sticking Out Into Our Universe ~
- SCP-632-JP - Human Internal Ants
- SCP-646-JP - A Retro-bender
- SCP-654-JP - Matryoshka
- SCP-656-JP - Human Repellant Plastic Bottles
- SCP-671-JP - The Night of Electric Jellyfishes
- SCP-682-JP - Tough Microbe
- SCP-737-JP - Merciful Jewelry Workshop
- SCP-747-JP - How To Boil Some Eggs In This Shifting Universe
- SCP-751-JP - EVERYBODY,FUCK YOU
- SCP-787-JP - How Those Vacuous Spines Got So Close To You
- SCP-818-JP - How great-
- SCP-828-JP - Launching Site
- SCP-830-JP - Downfall of One Night Castle
- SCP-831-JP - Lurking Summer
- SCP-835-JP -
XenophobiaKeteru Yamiko - SCP-838-JP - Urban Waves
- SCP-903-JP - Mr. Kojirō feat. Joyful Dancers
- SCP-905-JP - Freddie’s Special Flight Show
- SCP-918-JP - That's Someone else's Lost Dreams
- SCP-922-JP - Animal Relocation
- SCP-926-JP - Oneiric Eternal Recurrence Of The Nightmare Beast
- SCP-949-JP - Overrunning Bulldozer
- SCP-981-JP - Wenkankanhoyaukamuy
- SCP-1012-JP - Inversive Monotony
- SCP-1020-JP - Feeding Bowl for Chucky
- SCP-1044-JP - For Those Who Will Listen
- SCP-1045-JP - Corrective Lenses
- SCP-1078-JP - Less Guilt-Provoking Laboratory Organisms
- SCP-1100-JP - CAPTCHA
- SCP-1118-JP - Tokyo DisneySky
- SCP-1134-JP - Explosive Nigiri Sushiblade
- SCP-1139-JP - Electronic Diva
- SCP-1201-JP - Lakebed Electronics Store
- SCP-1242-JP - Abyssal Toilet Stall
- SCP-1249-JP - People
- SCP-1299-JP - They're All Alive
- SCP-1300-JP - An Offering to S
- SCP-1302-JP - Revolving.
- SCP-1304-JP - The Day the Wild Thistle Fell
- SCP-1305-JP - Infinite Monkey Would Never Abuse Drugs
- SCP-1330-JP - Crackti
- SCP-1332-JP - Mule at the Edge of the World
- SCP-1334-JP - Towards the Beach
- SCP-1357-JP - Kingfisher, Shining As Bright As Fire
- SCP-1379-JP - annoying omnipotent
- SCP-1405-JP - British White Silver Garden
- SCP-1407-JP - Chicks could remember
- SCP-1431-JP - I Really Wanna make them into Moss.min.js
- SCP-1440-JP - と
- SCP-1444-JP - Reenacting Proof for the Sake of Pleasure
- SCP-1475-JP - Target North Carolina!
- SCP-1494-JP - The Roadkill is Always Watching Over Us
- SCP-1495-JP - The Bystander is Only Watching for All Time
- SCP-1548-JP - You Offend My Eyes
- SCP-1566-JP - When the Body Dies, the Mind Also Dies; and When the Mind Dies, the Body Is As Good As Dead
- SCP-1576-JP - Hence the God Exists
- SCP-1577-JP - The Cow Lay Down On The Grass Because It Was So Starving
- SCP-1579-JP - A Man's Neighbor
- SCP-1581-JP - Graveyard is Full of Balloons
- SCP-1646-JP - Everything is in a Dream
- SCP-1657-JP - Eyedrops From the 2↑↑↑↑2nd Floor
- SCP-1673-JP - Moses and the Hot Springs
- SCP-1677-JP - Space Jumper
- SCP-1687-JP - With You, Someday/Eternally
- SCP-1690-JP - Tān, or Ouroboros
- SCP-1693-JP - Birth of the Prison
- SCP-1709-JP - Katana of Poetic Justice
- SCP-1710-JP - CHOPIN GODZILLA
- SCP-1721-JP - Love-Doll Retriever
- SCP-1732-JP - Toutei - Invitation
- SCP-1748-JP - Someday Somewhere
- SCP-1774-JP - Natural Apple
- SCP-1783-JP - The Ship is Full of Rabbits
- SCP-1792-JP - Guillotine Lemonade, Friendly Price 25¢
- SCP-1803-JP - Perpetual Generator, or a Black Box
- SCP-1810-JP - QR Bird
- SCP-1828-JP - Foggy Forest
- SCP-1841-JP - Don't Get Off Your Pedestal
- SCP-1857-JP - Cherry Blossom of Permanence
- SCP-1866-JP - A Job to Save the World
- SCP-1868-JP - Freed Headless Feline Carcasses (they can't go anywhere in the first place, and the neighbors don't give them a shit)
- SCP-1873-JP - Yoke of Flesh
- SCP-1876-JP - Out of Mom
- SCP-1934-JP - Shiba Inu on the Suspension Bridge
- SCP-1936-JP - This Connection Has Been Severed by a Nightmare Collective
- SCP-1944-JP - Unfortunate Flying Object
- SCP-1977-JP - Death Got A Non-Aquaphobic Horse
- SCP-1978-JP - Sailor Suit and Machine Gun
- SCP-1988-JP - Heisei Convenience Store Myths
- SCP-1995-JP - Ushi-Gozen
- SCP-1998-JP - A Girl Who Changes Shape with Extreme Force and a Super Deranged YouTuber
- SCP-2005-JP - Sword of Judgement, Bell of Forgiveness
- SCP-2048-JP - An Ordinary Coin
- SCP-2057-JP - Back to the Egg, Then It Hatches
- SCP-2061-JP - Adventure Tale at Gyouseiya Department Store
- SCP-2077-JP - Turing Shredder
- SCP-2113-JP - And He Closed His Eyes
- SCP-2152-JP - Tranquility, Anxiety, Drinking Down into the Darkness
- SCP-2170-JP - Oneigal Upload
- SCP-2188-JP - Light Fingers with a Ready Tongue
- SCP-2200-JP - BBC
- SCP-2203-JP - Reset
- SCP-2211-JP - Foundation Department of Hell
- SCP-2227-JP - Tell Me Stories
- SCP-2233-JP - He Who Was Mourned By As Many People As Possible
- SCP-2300-JP - Whether I Stay or Not, I May Never Go Anywhere
- SCP-2351-JP - Virtue's Vengeance
- SCP-2371-JP - Soytaurus
- SCP-2403-JP - Invasive Species Throwing Dude
- SCP-2422-JP - Language Kusōzu
- SCP-2424-JP - Lincoln Century
- SCP-2426-JP - Won't You Jump Out At Me From That Corner?
- SCP-2429-JP - Pufferfish Eten
- SCP-2433-JP - Wrongful Indulgence
- SLOT UNALLOCATED - That Which Kills Me
- SCP-2459-JP - It Must Be a Warm Place That Leads to Hell
- SCP-2472-JP - Nyankoderoga
- SCP-2476-JP - cat.exe (Modification Prohibited)
- SCP-2493-JP - Broken Smile
- SCP-2503-JP - Those Who Wait for Absolute Zero
- SCP-2505-JP - Processed Quail
- SCP-2507-JP - Jumpscaring Ghosts
- SCP-2513-JP - At Least, Be the Foundation
- SCP-2566-JP - RETURN PARADOX
- SCP-2580-JP - The Great Death
- SCP-2581-JP - Make Me Look Pretty☆
- SCP-2601-JP - "Me, and Yayoi, and Miyuki, and…"
- SCP-2613-JP - Fear Conditioner
- SCP-2626-JP (SCP-262-IE) - Casadh an tSúgáinTangled Thread
- SCP-2642-JP - Making "Project Arca"
- SCP-2650-JP - Transfeuneral
- SCP-2687-JP - Meaning of Life/Meaning of Death
- SCP-2707-JP - Floral Tribute for Me
- SCP-2733-JP - The Road To Hell Is Paved All Over With Good Intentions, Even Having Information Signs
- SCP-2744-JP - てるてるネコちゃん
- SCP-2755-JP - A Star at the Bottom of a Lake
- SCP-2760-JP - Dazzling with gold
- SCP-2784-JP - Someone is Talking About You Somewhere
- SCP-2788-JP - Your nth Dead Grandma
- SCP-2790-JP - Foundation Department of Retention
- SCP-2833-JP - SKYWELLS: THE SECOND
- SCP-2840-JP - The Room
- SCP-2844-JP - Cognitive Dissonance
- SCP-2851-JP - No Longer Red Needed
- SCP-2855-JP - SKYWELLS: THE FIRST
- SCP-2856-JP - My Hero
- SCP-2880-JP (Unassigned Number)
- SCP-2891-JP - Interstellar Retribution
- SCP-2904-JP - How Many Pigs Have You Ever Murdered?
- SCP-2920-JP - Strangulation Demon
- SCP-2955-JP - Septette for the Dead CN-Aniki
- SCP-2973-JP - The Man with the Most Powerful Abilities Ever
- SCP-2975-JP - "Cuz When I'm Up Late, I Wanna Eat Somethin'"
- SCP-2989-JP - The Star of My Wish Rises in the Clear Blue Sky
- SCP-666-JP-J - The Ultimate Horrible Object
- SCP-999-JP-J - The Tickle Master
- SCP-Shrimp-JP-J - ＞ A saury ＜
- SCP-K2-JP-J - Oh shit !!!
- 5Ç卩-譁?ｭ怜喧縺-JP-J - Untellable
- SCP-014-JP-EX - I Just Wanted to See that Look on your Face
Немецкий филиал
- SCP-009-DE - Cheap Gas
- SCP-015-DE - Dr. Duck
- SCP-017-DE - R.T.I. Grizzly A1
- SCP-028-DE - Sonderkommando for the paranormal
- SCP-030-DE - R.T.I. Hammer P1
- SCP-031-DE - Isabelle
- SCP-034-DE - Shower of dread
- SCP-042-DE - Avoid Containment
- SCP-045-DE - What are you searching for?
- SCP-046-DE - Shuffling Corpse
- SCP-051-DE - Mr. Soother
- SCP-056-DE - R.T.I Sentinel
- SCP-058-DE - Peaceful Zombies
- SCP-066-DE - The little Spellbook
- SCP-070-DE - Pink Colony
- SCP-076-DE - Face-Swap App
- SCP-083-DE - Badge of Physical Fitness
- SCP-087-DE - Confused AI
- SCP-089-DE - The Athena Project
- SCP-090-DE - I‘m SCP!
- SCP-091-DE - The Loving Doll
- SCP-096-DE - A Cosmic Phenomenon
- SCP-098-DE - Demon vs Machine
- SCP-099-DE - Gasmen
- SCP-100-DE - The gargoyle's misdeeds
- SCP-101-DE - Eik, the Tree of Knowledge
- SCP-117-DE - The News of the Day to Come
- SCP-121-DE - Telepathic humanoid
- SCP-122-DE - Frau Harlekina
- SCP-124-DE - Don't notice me
- SCP-125-DE - The Imprisoned Regent
- SCP-131-DE - Real Estate Shark
- SCP-136-DE - The boy who stops time.
- SCP-137-DE - Ice Phoenix
- SCP-140-DE - Morts volantes
- SCP-148-DE - Blue Slime [Level 25]
- SCP-149-DE - The Spirit of Ruin
- SCP-150-DE - Die Verteidiger
- SCP-173-DE - Hating Stones
- SCP-177-DE - The Rungholt Shard
- SCP-178-DE - Dreamlike Weather
- SCP-179-DE - To the most Righteous
- SCP-180-DE - A little cute Birthdaypenguin
- SCP-184-DE - Arachnophilia
- SCP-186-DE - The True Meaning of Christmas
- SCP-187-DE - Mathilda
- SCP-188-DE - B4 “Blitzgewitter”
- SCP-190-DE - Thor, God of Kebab
- SCP-192-DE - "Knowledge"
- SCP-200-DE - Higher Mathematics
- SCP-201-DE - Metal Dragon
- SCP-204-DE - The Chest of Eternity
- SCP-207-DE - The heart of Cupido
- SCP-208-DE - St Caesarius Hospital
- SCP-209-DE - The idiot box
- SCP-226-DE - Knight Cuddle Steel
- SCP-227-DE - Moo
- SCP-234-DE - A Christmas miracle
- SCP-236-DE - A cup of love
- SCP-237-DE - Her heart and his soul
- SCP-239-DE - USB Jird
- SCP-248-DE - Omni fork
- SCP-255-DE - The Perfect Mascot
- SCP-257-DE - A butt ugly owl
- SCP-260-DE - Ahead of her time
- SCP-272-DE - Megalodon
- SCP-281-DE - A pretty good hotel
- SCP-292-DE - Sweet Easter
- SCP-293-DE - Aliens, go home!
- SCP-296-DE - In death we blossom
- SCP-297-DE - Combustible Deep-Sleep
- SCP-299-DE - What the Future Holds
- SCP-004-DE-EX - Repulsive
- SCP-015-DE-J - This is why the SCP Foundation hates Ducks and Geese
- SCP-027-DE-J - The Big Bad Tap Hen
- SCP-033-DE-J - Earworm
- SCP-044-DE-J - This damn schnapps
- SCP-(INSERTANYNUMBERHERE)-DE-J - The Trainee
- The Things Dr Ore Is Not Allowed To Do At The German Branch Of The Foundation
Итальянский филиал
- CODENAME: /GRAF - The Dragon Of Revelation
- CODENAME: /ABAD - The Values Of The Fatherland
- SCP-002-IT - The Voice of the Piave
- SCP-010-IT - Parental Care
- SCP-011-IT - The Zero Zone
- SCP-012-IT - Waltz No. 2
- SCP-013-IT - Sentient Tornado
- SCP-015-IT - The Boogeyman
- SCP-017-IT - Sentient USB Pendrive
- SCP-018-IT - EMP Barn Owl
- SCP-019-IT - E-15 Chimera
- SCP-020-IT - Horse with Oratory Skills
- SCP-021-IT - The Capitoline Wolf
- SCP-022-IT - Legion
- SCP-023-IT - Hounds of the Dictator
- SCP-024-IT - Rebar ಉ
- SCP-025-IT - Kangaroo Mother
- SCP-029-IT - The Last Vestal
- SCP-032-IT - Haruspex
- SCP-035-IT - The Hammer
- SCP-037-IT - Subtle Vibration
- SCP-038-IT - Ocean Stones
- SCP-039-IT - Cordless Telephone
- SCP-041-IT - A Flat World
- SCP-042-IT - The Answer
- SCP-045-IT - The Hypogea of the Daunia
- SCP-050-IT - The Galleass
- SCP-054-IT - Microcosmos
- SCP-055-IT - The Devourers
- SCP-057-IT - Under the Sea
- SCP-066-IT - Diabolus ex Machina
- SCP-067-IT - The King of the Hill
- SCP-068-IT - Kaliperia
- SCP-070-IT - Forgotten Depths
- SCP-071-IT - Ötzi's cloak
- SCP-079-IT - Locus Amoenus
- SCP-080-IT - Shattered Civilization
- SCP-082-IT - The Helmet of Knowledge
- SCP-100-IT - Carnem Levare
- SCP-103-IT - Ciapapuer
- SCP-105-IT - Anachronistic Hallucinogenic Excrements
- SCP-149-IT - After the End of the Eternity
- SCP-004-IT-ARC - Infinite Tuning Guitar
- SCP-008-IT-ARC - The Hotel
- SCP-014-IT-ARC - XXXIII (Before Rewrite)
- SCP-001-IT-J - The “Dragon” Of Revelation
- SCP-002-IT-J - The Doctor-Destroyer
- SCP-610-IT-J - The Perfect Projectile
- SCP-1900-IT-J - The Pirate Kingdom
- SCP-F2Y-IT-J - The [EXPLICIT]
- Italian Sites -J - The best Sites of the Italian Branch!
Украинский филиал
- SCP-012-UA - The Library
- SCP-035-UA - Tablet of Veles
- SCP-038-UA - Alike to black holes
- SCP-046-UA - Tasty flashbacks
- SCP-049-UA - Apparently… God?..
- SCP-054-UA - Pater noster Bandera
- SCP-056-UA - Pit on the road
- SCP-065-UA - Deliver Us From Evil
- SCP-069-UA - Cast-iron charcoal iron
- SCP-079-UA - No-Sides
- SCP-081-UA - Vanka-Vstanka
- SCP-095-UA - Crazy Bee
- SCP-2014-UA-EX - SCP-2014-RU
- SCP-692-UA-J - Connection cockup
Португальский филиал
- CODINAME: Project Bulwark - by slashannemoo & Vintner
- SCP-002-PT - Women's Magazine
- SCP-003-PT - Silent Droplets
- SCP-004-PT - The Soldier and the Bomb
- SCP-006-PT - Freefalling Nightmare
- SCP-008-PT - Man-Man
- SCP-010-PT - Peppers
- SCP-011-PT - Victoria stella
- SCP-013-PT - Crazy Cyborg's Samba
- SCP-014-PT - Improvised Appearances
- SCP-015-PT - Electromagnetic Cannon
- SCP-016-PT - The Holy Grail
- SCP-018-PT - Unrecorded Man
- SCP-019-PT - Porcelain Dish
- SCP-021-PT - Crystal Theatre
- SCP-022-PT - Lawyers = Fairies and Vice Versa
- SCP-023-PT - Xeno's Paradox
- SCP-024-PT - A Longtime Friend
- SCP-025-PT - Portable Desert
- SCP-026-PT - Sober Drunk
- —————— - This Shouldn't Exist
- SCP-030-PT - Cultural Heritage
- SCP-031-PT - Pocket Imp
- SCP-034-PT - Creator Magnifying Glass
- SCP-035-PT - The Pigeon
- SCP-038-PT - Floating Snake
- SCP-040-PT - Ostium Theater
- SCP-041-PT - A Weapon Among the Stars
- SCP-042-PT - The ████ Opener
- SCP-043-PT - The Player
- SCP-046-PT - Read a Book, Write a Book
- SCP-049-PT - <N0:.WH3RE>
- SCP-050-PT - The Sack Man
- SCP-055-PT - Adaptive Tactical Armour for Containment and Assault
- SCP-057-PT - The Abandoned Hospital
- SCP-065-PT - Hard-to-Kill Armadillo
- SCP-078-PT - The Fog
- SCP-079-PT - Schrödinger's Planet
- SCP-088-PT - This Machine Kills Commies
- SCP-089-PT - I Shall Deeply Love You
- SCP-094-PT - Apamachi Identity Camouflage Device.
- SCP-101-PT - Manor of Madness
- SCP-106-PT - Sonic Flashlight
- SCP-110-PT - A Very Convincing Story
- SCP-118-PT - That Which Shares
- SCP-119-PT - The Pompous Girl
- SCP-122-PT - Factor XX
- SCP-143-PT - Escape from the Rio-Niterói Bridge
- SCP-150-PT - P███ G████´s Progressive Location Pen
- SCP-166-PT - The Light of the Court
- SCP-170-PT - [31/12/2025]: thank you.
- SCP-172-PT - Mother-of-Gold
- SCP-177-PT - Time Travelling Lottery
- SCP-191-PT - Acre's UFO
- SCP-195-PT - Special Gift for Naughty Workers
- SCP-196-PT - Midas Gloves
- SCP-199-PT - Spread the Word
- SCP-033-PT-EX - Dream-Catcher
- SCP-019-PT-J - The Big Ban Hammer
- SCP-045-PT-J - Monsterwave
- SCP-075-PT-J - Good Morning!
- SCP-109-PT-J - The Foundation
- SCP-005-PT-ARC - The Reason Why Dendrophobia Exists
- SCP-012-PT-ARC - Socrates
Чешский филиал
- SCP-017-CS - Absolute Justice
- SCP-023-CS - Why can't he just leave me alone?
- SCP-042-CS - Northern Devil
- SCP-073-CS - The cousin of Winnie the Pooh
- SCP-082-CS - Captive of a frequency
- SCP-087-CS - Splendid Light
- SCP-148-CS - Unfinished Business
Традиционный Китайский филиал
- SCP-ZH-002 - Taiwanese Unicorn
- SCP-ZH-003 - Extreme Religion
- SCP-ZH-004 - Marslow’s Daughter
- SCP-ZH-005 - If you haven't re-shared this article with ten friends, then…
- SCP-ZH-006 - The real meaning of popcorn
- SCP-ZH-037 - Tears from Hawksbill Sea Turtle
- SCP-ZH-038 - The Faceless Model
- SCP-ZH-041 - Dreams
- SCP-ZH-048 - Sword & Sorcery and Tea & Magic Hands
- SCP-ZH-060 - The Deer Road Tunnel
- SCP-ZH-105 - The Unfilials
- SCP-ZH-132 - The 007 Game That Kills You
- SCP-ZH-178 - The Bird Mug
- SCP-ZH-200 - Let's Tag
- SCP-ZH-228 - Tsuipu, 1947
- SCP-ZH-236 - Last Year Syndrome (Senioritis)
- SCP-ZH-251 - Ruins In Third Floor
- SCP-ZH-261 - Cuban Sugar
- SCP-ZH-282 - The Gourmet
- SCP-ZH-310 - Anomalous Protein Domain
- SCP-ZH-446 - Became Bug
- SCP-ZH-526 - I’m Just a Toaster
- SCP-ZH-545 - I'm Not A Dinosaur
- SCP-ZH-617 - The Brave One From the West
- SCP-ZH-618 - Sun Pastry Lion
- SCP-ZH-736 - You Can't Go Any Further
- Mrs. Alicia
- SCP-ZH-860 - dado's Hair/Have-fortune Drug
- SCP-ZH-889 - Beyond This World
- SCP-ZH-973 - As Your Hatred
- SCP-ZH-2005-EX - Internet Celebrity
- SCP-ZH-9288-EX - You are completely aware that you will never meet the person sitting next to you listening to your story ever again.
- SCP-ZH-00l - SCP-ZH-001
- SCP-ZH-60053-J - HONK
Вьетнамский филиал
- SCP-002-VN - Funeral
- SCP-006-VN - The Night Stars
- SCP-012-VN - One Gains, What One Wishes
- SCP-013-VN - Poisonous Milk
- SCP-014-VN - Dream Crayons™
- SCP-018-VN - The Two-Wheeled Hatred
- SCP-024-VN - The Beginning of All
- SCP-033-VN - Rubber Duck
- SCP-036-VN - The Cube
- SCP-040-VN - Those Black Words
- SCP-096-VN - Where the Earth Meets the Tide
- SCP-099-VN - The Waifu Heaven
- SCP-100-VN-J - The True Omnipotent SCP
- SCP-6789-VN-J - A Kettle-Class Loudspeaker
Фрагмент списка для редактирования
- CODENAME: Cimmerian/kaktus Proposal - "The Broke God"
- CODENAME: Henzoid-Crocket's Proposal - "When Day Breaks Up"
- CODENAME: Director Bold's Proposal - "Guys, please don't read our SCPs 🥺"
- CODENAME: Fishish's Proposal - "Truth Hurts </3"
- CODENAME: Plauge's Proposal - The Great Seal
- SCP-002-J - Amnesiac Treatment
- SCP-004-J - Stan from Accounting
- SCP-6k-J - Out of the Mouths of Babes
- SCP-7K-J - Upvote/Downvote Coin
- SCP-8==D-J - Monster Containment for My Monumental Dong
- SCP-015-J - Just Really Misunderstood
- SCP-017-J - Narcissistic Time Displacement Field
- SCP-018-J - Normal Trench Coat Worn By An Adult
- SCP-027-J - Schrödinger's Remote
- SCP-027-DE-J - The big bad tap hen
- SCP-029-J - Jesus Take the Wheel!
- SCP-031-J - Evening of Terrors
- SCP-042-J - Billions of Anomalous Pillows
- SCP-044-J - SCP-J(argon)
- SCP-044-DE-J - This damn schnapps
- SCP-063-J - Non-Euclidean Geometries
- SCP-80s-J - Strangerer Things
- SCP-80-K-J - Chicken Corps
- SCP-093-J - Failed Embezzlement Scheme
- SCP-096-J - NarrAway
- SCP-ES-101-J - The Hard-To-Open Container
- SCP-103-J - Confirmed
- SCP-106-J - The Barbecue Man
- SCP-0110-J - Personal Retirement, Effective Immediately
- SCP-118-J - The Saltiest Doctor Alive
- SPC-126-J - Not Shark For Work
- SCP-143-J - insert witty name here
- SCP-164-J - Ear Magic
- SCP-184-J - The Elaboration Squirrel
- SCP-222-J - Contagious Biophysical Behavior
- SCP-248-J - Picture It
- SCP-273-J - ‘Freezies’
- SCP-294-J - Genesis, Freshly Brewed
- SCP-300-J - Our Glorious Ruler
- SCP-314-J - Numerical Proofs (That You Suck)
- SCP-334-J - The Lost Sock Room
- SCP-419-J - A Trustworthy Man
- SCP-444-J - Six Day Long Fruit Preserves Convention
- SCP-477-J - This Should Be A Mainlist
- SCP-543-J - Tweetle Beetles
- SCP-555-J - Squid Mop
- SCP-615-J - Diplomatic Immunity
- SCP-630-J - A Song In Their Heart
- SCP-661-J - Crippling Indecisiveness
- SCP-721-J - A Stupid Dog Picture
- SCP-732-J - Tiny Ceramic Seahorse
- SCP-733-J - System Of A Down
- SCP-800-J - American Football
- SCP-810-J - A Dog In Need Of Funds
- SCP-900-J - Modern Major Keter-Class
- SCP-930-J - You little rascal!
- SCP-939-J - Crime Time Canine
- SCP-990-J - Dream Dude
- SCP-1020-J - Fridge Horror
- SCP-1040-J - A Dangerous Mental Contagion
- SCP-1049-J - The Grim Bucket
- SPC-1057-J - Absence Of Punchable Shark
- SCP-1089-J - The Carpet Ate It Again
- SCP-1111-J - A Working Computer
- SCP-1131-J - It works, guys! Trust me!
- SCP-1132-J - Head-Cannons
- SCP-1134-J - Masking Tape
- SCP-1162-J - "Double Down Sandwich"
- SCP-1224-J - Duck-Class Personnel
- SCP-1256-J - Bees are Dumb as Fuck, Much More So than You Could Possibly Imagine
- SCP-1294-J - Watering-down Can
- SCP-12954-J - Damn, That's Deep
- SCP-1417-J - Passive-Aggressive Meteorite
- SCP-1472-J - Scranton Realty Anchors
- SCP-1557-J - The Writer's Block
- SCP-1595-J - Sweethearts
- SCP-1622-J - No Object Class Whatsoever
- SCP-1638-J - A Dark and Mysterious Printing Plate
- SCP-1797-J - "GEORGE WASHINGTON ENTERTAINING A GENTLEMAN FRIEND WHILE PICKING HIS NOSE"
- SCP-1830-J - Opening Line
- SCP-1840-J - The Hard Sell
- SCP-1851-J - Fibber Lake
- SCP-1914-J - Silencing Piano
- SCP-1921-J - Riemann's Router
- SCP-1939-J - FIX MY FUCKING ROOF
- SCP-1948-J - The Comrade
- SCP-1950-J - Locked away in the tallest Containment Cell
- SCP-1955-J - Musical Audio Surveillance Distortion
- SCP-1981-J - Just A Small Town Girl
- SCP-1997-J - Pro-Pain
- SCP-2001-J - Laser Butt Disease
- SCP-2002-J - The -J stands for Jaywalker
- SCP-2019-J - a shaggy dog
- DDD-2034 - Destroy, Destroy, Destroy
- SCP-2100-J - Hard-Boiled Fedora
- SCP-2130-J - "But seriously, folks…"
- SCP-2421-J - The Upvote Syndrome
- SCP-2600-J - Bicycle Mafia
- SCP-2618-J - Then Who Was Nanners?
- SCP-2718-J - Weekend at Dammerung's
- SCP-2719-J - an inside joke
- SCP-2772-J - SUV Sales Pitch
- SPC-2935-J - O, Fin
- SCP-2950-J - THE POSTCARD
- SCP-3001-J - Brown Reality.
- SPC-3008 - A Perfectly Normal, Regular Old BLÅHAJ
- SCP-3034-J - Voresnake
- SPC-3284-J - Lava Sharks
- SCP-3333-J - Angsty Teenage Plant
- SCP-3448-J - Should Have Taken Him Sleeping
- SCP-3472-J - In time, you will come to hate me.
- SCP-3560-J - A Discerning Gentleman
- SCP-3790-J - Pantopicon IV: The Search for Pantopticon III (sic)
- SCP-4000-J - 2boo
- SCP-4001-J - Life, Read Right to Left
- SCP-4237-J - Object of Indescribable Action
- SCP-4263-J - Googly Eyes
- SCP-4297-J - Normal Australian Wildlife
- SCP-47-47-J - Rusty the Wonder Dog
- SCP-4800-J - The One True God
- SCP-5040-J - Stripèd Gangs
- SCP-5150-J - Think Of The Children
- SCP-5200-J - JUST SAY NO!!!!!!!!
- SCP-5280-J - Antiquated Measurement System
- SCP-5417-J - The Deadly Nackle
- SCP-5846-J - Author's Commentary
- SCP-6000-Jay - The Great Gatsby by F. Scott Fitzgerald
- SCP-6009-J - HerbiVore!? I Barely Even Know Her!
- SCP-6132-J - Terrain Fumble
- SCP-6140-J - The Br*tish Empire
- SCP-6269-J - The Multiversal Fishing Machine
- SCP-6283-J - Standard Foundation Procedure
- SCP-6395-J - [untitled fish article]
- SCP-7007-J - Subs Only!
- SCP-7143-J - THE KNOB
- SCP-7394-J - HILARIOUS FARTING FROG CLICK NOW TO SEE
- SCP-7475-J - Turbo Shark Pulverizer 6000
- SCP-7560-J - Deccadence, Being the Writings of Wisest RESEARCHER Frank Gene Decray
- SCP-7789-J - There are so many possible puns for this! Some are too phon-ny and others won't fly.
- SCP-7800-J - The Five-Second Rule
- SCP-8003-J - Why Bother?
- SCP-80RK-J - Unfortunately The Best Doggo
- SCP-8231-J - Super Flying T-Rex
- SCP-8851-J - Super Cheap Procedures
- SCP-9999-J - Ground Beef
- SCP-19316-J - Improper Terminology
- SCP-99826-J - The Mind Screw
- SCP-41D3N73-J - Lotsa Pasta
- SCP-649-2568-J - Technicolor Geography
- SCP-1347-1353-J - What a Pestis
- SCP-32-J - The Criminal
- SCP-BLANK-J - Curse You, Antimemetics!
- SCP-CASH4D-J - The People Person
- SCP-COOL-J - A Really Cool Guy
- SCP-Ducks-J - KILLER SALES AT SITE-19!!!
- SCP-HR009-J - Eye-Grabbing Clickbait Title
- SCP-Jaguar-J - Junior Researcher Hutchins' Incredible Automobile
- SCP-L135-J - Very Powerful Psychic Man
- SCP-META-EX-J - Please Don't Coldpost
- SCP-META GUN-J - Guns Pointed At The Balls Of God
- SCP-MWT-J - [SELF-PROPAGATING DANGER]
- SCP-O5-J - Sorry, I do not understand the command.
- SCP-PU1P-J - A PULPy Machine
- SCP-ROCKS-J - A Pile Of Rocks That Need To Shut The Hell Up
- SCP-SAFE-J - Some safes
- SCP-SPC-J - "Shark" "Punching" "Center"
- SCP-SPDR-J - Arachnophobic Colleague
- SCP-sqrt(-1)-J - SCP-
\sqrt{-1}-J - SCP-SQYD-J - Sqyd Game
- SCP-TLDR-J - An Easily Digestible Document
- SCP-V1L3-J - A VILE Machine
- SCP-WCPGW-J - You're Thinking Too Much
- SCP-WOW-J - Dr. Fynegan and Agent Forelli's Bizarre Adventure
- SCP-@#%&!-J - Titters The Talking Bird
Фрагмент списка для редактирования
- SCP-012-EX - Eurydice
- SCP-067-EX - "Rurik Inn"
- SCP-252-EX - A Completely Normal Bomb
- SCP-445-EX - The Word of the Day is Hope
- SCP-726-EX - The Dowsing Rod
- SCP-1337-EX - NFTs by Vikander-Kneed!
- SCP-1401-EX - Have You Been Scrombled?
- SCP-1512-EX - 3D Bioprinting
- SCP-1551-EX - Señor Pig
- SCP-1927-EX - Farnsworth Effect
- SCP-1964-EX - A Massive Problem
- SCP-2001-EX - M̸̮͂a̸͎͋m̶̙̀a̷͖͗n̷̈́ͅ,̴̭͊ ̴͖̃Ẃ̶͈h̷̤͘y̷͍̚ ̴̞͒D̵͖̀o̴̞̔ḙ̶͐ṣ̸̏ ̸̡̌M̷͔͗ỵ̷̚ ̶̀͜H̷͙͒e̶̟͆ä̸̪́d̷̝͗ ̵̻̀H̴̭́û̴̡r̸̛̹t̷̤̆?̶̧̾
- SCP-2011-EX - Temporary Secretary
- SCP-2023-EX - Capable Athletes
- SCP-5054-EX - The Memetic Myth of Joe Who?
- SCP-5297-EX - ROUGH DRAFT EDIT FOR BREVITY DO BY THURSDAY
- SCP-5735-EX - "Mystery 32" (2104)
- SCP-6192-1-EX - Mirror Inspection
- SCP-7000-EX - Awesome Points™
- SCP-7525-EX - The Slot Goblin
Структурные:
публичный_черновик
версия страницы: 9, Последняя правка: 11 Янв. 2025, 08:35 (10 дней назад)