Предисловие: Список создан для максимально удобной навигации. Бывает такое, что, листая список англовики, натыкаешься на интересный объект, который хочешь перевести, но обнаруживаешь его на русскоязычной вики уже в процессе перевода. Кроме того, иногда очень сложно мониторить список переведённых статей на предмет пропущенных номеров.
Просьба после публикации в основном пространстве удалять из списка переведённую статью,а при публикации оной на Полигоне - поставить в скобках после названия ссылку на перевод.
Кроме того, пожалуйста, сверяйтесь с текущими назначениями переводчиков в статье "Планы на перевод". Отмечать статьи, взятые на перевод, стоит именно там.
Примечание: Все ссылки во вкладке "Объекты других филиалов" взяты c сайта International Translation Archive, который содержит не полный список оригинальных объектов. При достаточном владении иного языка разрешается переводить объект с его основного сайта.
- 001-999
- 1000-1999
- 2000-2999
- 3000-3999
- 4000-4999
- 5000-5999
- Объекты других филиалов
- Шуточные объекты
- Обоснованные объекты
Фрагмент списка для редактирования
001-099
- SCP-001 - The Queen's Gambit
- SCP-001 - AMONI-RAM
- SCP-001 - The Placeholder
- SCP-001 - A Test of Character
- SCP-001 - The Frontispiece
- SCP-001 - The Conspiracy
- SCP-001 - Fishhook
- SCP-001 - The Solution
- SCP-001 - The Sky above the Port
- SCP-001 - The World at Large
- SCP-001 - Story of Your Life
- SCP-001 - Project Palisade
- SCP-001 - R ¦ A ¦ G ¦ E
- SCP-001 - The Ones That Got Away
100-199
200-299
300-399
400-499
500-599
600-699
700-799
- SCP-720 - Panopticon
800-899
- SCP-829 - Supersonic Can Opener
900-999
Фрагмент списка для редактирования
Содержание
1000-1099
1100-1199
1200-1299
1300-1399
1400-1499
1500-1599
1600-1699
1700-1799
1800-1899
1900-1999
1000-1099
1100-1199
- SCP-1168 - A Highly Immature and Completely Unofficial Parody
1200-1299
- SCP-1255 - Grapes from Dawn Farm and Ranch
1300-1399
1400-1499
- SCP-1444 - Hunger.
1500-1599
1600-1699
- SCP-1631 - La Vie En Rose
1700-1799
1800-1899
- SCP-1822 - The Quantification of Luck
1900-1999
Фрагмент списка для редактирования
Содержание
2000-2099
2100-2199
2200-2299
2300-2399
2400-2499
2500-2599
2600-2699
2700-2799
2800-2899
2900-2999
2000-2099
2100-2199
2200-2299
- SCP-2202 - A Brief Respite
- SCP-2212 - [MASSIVE DATABASE CORRUPTION]
- SCP-2223 - Spamdexing Anime Images
- SCP-2231 - A Shared Identity
- SCP-2234 - Great Deals on Pineal Removal
- SCP-2237 - "There is always a cost…"
- SCP-2238 - "Broadcasting Live From Out of Time"
- SCP-2247 - "What did I go through to seek a new employer?"
- SCP-2249 - The Failed Dreamland
- SCP-2270 - An Unnecessary Utilization of Excessive Force
- SCP-2271 - Factory Loans
- SCP-2275 - Where Muses Go
- SCP-2276 - Too many GRACE
- SCP-2277 - Andronika Optima Maxima
- SCP-2294 - The Problems At Hand
- SCP-2299 - Cephalensis-9
2300-2399
- SCP-2319 - Mirrored Shipwreck
- SCP-2325 - Involuntary Bullet Catching
- SCP-2326 - Phantom Bomber Fleet
- SCP-2338 - An Unorthodox Adoption
- SCP-2340 - Homesick Hills
- SCP-2354 - Nemesis
- SCP-2363 - The Womb Farm
- SCP-2374 - Transporting Washing Machines
- SCP-2375 - We're All The Same Down Here
- SCP-2377 - Your House
- SCP-2381 - Call of the Hyphae
- SCP-2390 - Illuminitis
2400-2499
- SCP-2407 - Learned Helplessness
- SCP-2418 - Hadrian's Well
- SCP-2425 - Fifth Church Recruitment Tool
- SCP-2426 - FutureSkip/LuxeShop
- SCP-2436 - One of the Huldufólk
- SCP-2447 - Modular Animals
- SCP-2448 - Castle of Guillaume the Guildmaster
- SCP-2456 - Dreams of a Broken World
- SCP-2459 - When the Traffic Clears
- SCP-2467 - A Sum Greater Than Its Parts
- SCP-2473 - Better Hide, Better Run
- SCP-2476 - I Didn't Expect That
- SCP-2479 - Animaland!
- SCP-2488 - Safety Harbor Milk Delivery Service
- SCP-2495 - The Well and the Pit
- SCP-2498 - The Rainbow Body
2500-2599
- SCP-2503 - Estimated Distance: 9,216 Years
- SCP-2520 - The Special Court
- SCP-2530 - The Emerald Choir
- SCP-2531 - The Pumpkin Man
- SCP-2534 - Future Pennies
- SCP-2535 - Printers that Eat, and Eaters that Print
- SCP-2541 - Like a Lemon, Sexuality Looks Beautiful and Alluring…
- SCP-2544 - The Call of the Void
- SCP-2546 - A Retroviral Nightmare
- SCP-2549 - Animal Assassins
- SCP-2553 - Juridical Person
- SCP-2555 - Growing Up
- SCP-2559 - "I've Heard There's Something Going Around"
- SCP-2560 - Polar Opposites
- SCP-2561 - Pet Radio Mast
- SCP-2562 - RTFM
- SCP-2564 - Willow Glen Community Hospital
- SCP-2566 - Demurrage
- SCP-2568 - Snap To Grid
- SCP-2577 - Falling Ships
- SCP-2581 - Greeting Card Rapture
- SCP-2588 - The Collective Consciousness of Arthur H. Jones
- SCP-2589 - Don't Leave Me This Way
- SCP-2596 - A Big Ship-load
2600-2699
- SCP-2601 - They Say You Die Twice
- SCP-2603 - Its Maiden Voyage
- SCP-2608 - Anomalous Indicator Species
- SCP-2609 - Traveling Lamp
- SCP-2613 - Never Leave the Fallen
- SCP-2618 - This Is How Confidentiality Works, Right?
- SCP-2625 - Chipperee Mine
- SCP-2626 - Large Format Camera
- SCP-2628 - Efficient Tenders of the Artifice
- SCP-2629 - The Twenty-Nine Year Paintball War
- SCP-2637 - A controversial chunk of rock with 196,884-dimensional stakes
- SCP-2641 - The Talk Spore
- SCP-2643 - A Remembered Pet
- SCP-2644 - LostPerson
- SCP-2647 - Premium
- SCP-2648 - CJ's Shroom Farm and the Angering of the Fleshball on Acid
- SCP-2651 - Gazing Upon a Failed Future
- SCP-2658 - A Convincing Proxy
- SCP-2671 - Baby Monitor
- SCP-2673 - The Hunter in Words
- SCP-2674 - An Ancient, Submerged Burial Ground
- SCP-2675 - The Cradle
- SCP-2676 - For S
- SCP-2677 - Obfuscation
- SCP-2680 - The Gorillas Simply Freeze to Death
- SCP-2681 - Animal Man
- SCP-2687 - Instant Organs
- SCP-2691 - Covered Bridge
- SCP-2692 - Remains of Subterranean France
- SCP-2694 - These Old Bones
- SCP-2696 - The Haunted Victorian Mansion of Dark Peak
2700-2799
- SCP-2704 - 🕷️ Beetle Royale 🕷️
- SCP-2708 - My Memetic Waifu
- SCP-2715 - Guilty Sister
- SCP-2717 - Fatberg
- SCP-2720 - Penguin Honeymoon Suite
- SCP-2722 - Straight on 'Til Morning
- SCP-2724 - X-Man
- SCP-2725 - Akron and Nemesis
- SCP-2729 - What is it Good For?
- SCP-2735 - Ancient Methanogens
- SCP-2738 - Anticapitalist POS System
- SCP-2739 - Ab Inconvenienti
- SCP-2742 - Caelivorous Remnants
- TATTLETALE - [ENTRY REMOVED FROM DATABASE]
- SCP-2752 - Junk Male
- SCP-2754 - A Festival For One, a Festival For None.
- SCP-2759 - As Within, So Without
- SCP-2761 - Bananazilla
- SCP-2765 - Caveat Dei
- SCP-2767 - Oppression Blue
- SCP-2780 - Temporal Anomaly, 618 Evergreen St.
- SCP-2782 - The Flock
- SCP-2785 - Self-Replicating Automaton
- SCP-2789 - Self-Replicating Fast Food Chain
- SCP-2791 - Fauste Bank plc
2800-2899
- SCP-2801 - All Your Brains Are Belong To Us
- SCP-2809 - Des Souvenirs
- SCP-2812 - Echoes of Yesterday
- SCP-2813 - Ghost Ship
- SCP-2820 - Vaishnavastra
- SCP-2823 - Fen Tigers
- SCP-2824 - The Once
and FutureKing - SCP-2830 - "the Knowledge"
- SCP-2832 - Hubris
- SCP-2836 - The Air Swimmer
- SCP-2843 - The Micro Landscape
- SCP-2858 - As Though The Wasps Themselves Had Worked It There
- SCP-2860 - Made of Stone
- SCP-2864 - Di Molte Voci
- SCP-2871 - Strong Interaction Amplifier
- SCP-2876 - Dream A Little Dream
- SCP-2887 - London Terminus
- SCP-2888 - Again and Again and Again
- SCP-2891 - Insta-Container!
- SCP-2892 - The Flying Dutchman
- SCP-2893 - A Bubble In Time
- SCP-2896 - To Sleep, Perchance to Dream (of Freedom)
- SCP-2897 - The Bard of Analytics
- SCP-2898 - A Persistence of Memory
2900-2999
- SCP-2903 - Garden of the Manichees
- SCP-2904 - Temporary Immortals
- SCP-2905 - A Web Wrapped With Roses and Poisons
- SCP-2916 - A Lamb, a Shepherd, and a Wolf
- SCP-2919 - Protect Kalmaris
- SCP-2929 - Undulating Obsidian Monolith
- SCP-2937 - A Pottery Set
- SCP-2942 - My Other Car is a Fighter Jet
- SCP-2943 - In Case Of Emergency, Break Glass
- SCP-2947 - Fidget Winners
- SCP-2953 - Polymorphism-Inducing Rocks
- SCP-2955 - Every Wandering Golden City of the Caesars
- SCP-2956 - We All Live in a Nuclear Submarine
- SCP-2958 - Marooned
- SCP-2961 - Los Ocultos
- SCP-2962 - Supacansa
- SCP-2968 - Stairway to Heaven
- SCP-2970 - Holy Misplacement
- SCP-2971 - Whole Lotta (Reality) Shakin' Goin' On!
- SCP-2975 - Another Sun
- SCP-2982 - Televon Telefex Secrecy-8
- SCP-2988 - Folly of the Fruit Eater
- SCP-2989 - Of Bookworms, Bamboo, and Beating Hearts
Фрагмент списка для редактирования
Содержание
3000-3099
3100-3199
3200-3299
3300-3399
3400-3499
3500-3599
3600-3699
3700-3799
3800-3899
3900-3999
3000-3099
- SCP-3010 - Causal-Absent Paranoia
- SCP-3011 - Loose Lips Skink Ships
- SCP-3012 - Smoke the Reefer, Meet the Reaper
- SCP-3013 - An Expression of Mourning
- SCP-3015 - A Story Concerning Self-Doubt, Slight Disillusionment, and Frustration, As Told By the Lucky Member of a Group Whose Relatable Works Are Loved Internationally
- SCP-3016 - Perpetual Motion Run Amok
- SCP-3019 - The Soylent Nursery
- SCP-3024 - The Doxx Ghost
- SCP-3025 - Lucidity
- SCP-3028 - Take On Me
- SCP-3032 - Ballistic Trees
- SCP-3033 - A Human Weapon
- SCP-3037 - A Model City
- SCP-3038 - A White Door
- SCP-3039 - An Antiquated Guide
- SCP-3040 - Give Her A Hand
- SCP-3042 - Dog Is Love
- SCP-3044 - Evolution In A Bottle
- SCP-3046 - Model TH-223
- SCP-3047 - To Be Drowned by A Train
- SCP-3048 - Tantalus
- SCP-3050 - Ogden
- SCP-3051 - Interactive Time Loop
- SCP-3053 - Off the Rails
- SCP-3055 - Yes, And
- SCP-3058 - Concavity
- SCP-3059 - Infictious Self-Insert
- SCP-3060 - Sleep Paralysis
- SCP-3061 - Reluctant Fiend
- SCP-3062 - The Lone and Level Sands Stretch Far Away
- SCP-3064 - Hymn of Courage
- SCP-3065 - The Man Cave
- SCP-3066 - Absurdity
- SCP-3067 - Interdimensional Pirate Radio Station
- SCP-3068 - Halycon Light Beta
- SCP-3070 - Highly Unusual Attempts at Solar Conquest
- SCP-3071 - To Deny Sense
- SCP-3072 - They're Trading Away Our Lives Out There
- SCP-3075 - A Day At The Beach Is All It Takes
- SCP-3076 - Avidity
- SCP-3077 - Sugar Golems
- SCP-3079 - 300 Tricks: Stage Magic Made Easy
- SCP-3080 - The Power of Love
- SCP-3082 - Neverland's Lost Boys and Girls
- SCP-3084 - Seven Strangers at a Feast
- SCP-3085 - Seasons Change
- SCP-3087 - The Owl-Car
- SCP-3088 - Law Of The Land
- SCP-3089 - That Old Time Religion
- SCP-3090 - This girl's gone bad on a game attack!
- SCP-3091 - Temporal Funnel Trap
- SCP-3092 - Gorilla Warfare
- SCP-3093 - The Color Vulvide
- SCP-3094 - Fall into the Gaap
- SCP-3097 - A Game Of Fetch
- SCP-3098 - Triviality
3100-3199
- SCP-3100 - The Reliquary
- SCP-3101 - Contain Me Harder
- SCP-3102 - The Conflagration
- SCP-3103 - Vengeful Wings
- SCP-3104 - Cops Magnet
- SCP-3105 - Laxity
- SCP-3106 - A Flesh Removing Bog
- SCP-3107 - The Well Documented Marble
- SCP-3108 - The Nerfing gun
- SCP-3109 - Indeterminate Source
- SCP-3110 - One Man's Trash…
- SCP-3112 - InDi-Mail
- SCP-3115 - 99.7 Cognitohazard FM
- SCP-3116 - It's time to stop posting
- SCP-3119 - Lord of the Dance
- SCP-3120 - Help Desk
- SCP-3121 - Get Out of My Head
- SCP-3122 - You Have Reached Your Destination
- SCP-3123 - Insult To Injury
- SCP-3126 - The Immobile Muse
- SCP-3127 - Nineteen Year Old Jessica Lambert And A Female Pig Of Abnormal Size, Forever
- SCP-3129 - Mr. November
- SCP-3132 - Crackin' the Back Knack
- SCP-3134 - The Things Left Behind
- SCP-3135 - Star Trek: The Next Generation: The Journey Continues!
- SCP-3139 - America's Labyrinth
- SCP-3140 - Botanical Warfare
- SCP-3141 - Anomalous Theorem
- SCP-3142 - If you can dream it, you can do it (as long as your dream is of being broke)
- SCP-3144 - The Real World Is Faker Than Wrestling
- SCP-3145 - Self-Insert
- SCP-3146 - Money Match
- SCP-3147 - Tongue Twisted
- SCP-3148 - Tranquility
- SCP-3151 - Movie in a Bottle
- SCP-3152 - The Last Love Letter
- SCP-3153 - Bugging Me
- SCP-3155 - We Never Sleep
- SCP-3156 - Civilization Carrier Case
- SCP-3157 - The Second Castle
- SCP-3161 - The Plight of Poor Sir Gregor
- SCP-3162 - Social Life
- SCP-3163 - The Almanack
- SCP-3164 - Character Test
- SCP-3165 - Dog Teeth
- SCP-3167 - Character Assassin (Or: The Serial Killer)
- SCP-3169 - finna nut
- SCP-3172 - A Field Of Unfortunate Flowers
- SCP-3173 - Forest Prison
- SCP-3174 - Kleiner Freund
- SCP-3175 - A Wish Granted
- SCP-3176 - Estimated Time Of Arrival
- SCP-3178 - Through God, All Things Are Possible
- SCP-3180 - No Strangers to Love
- SCP-3181 - Lemme Get It Boneless
- SCP-3182 - The Grocery Store
- SCP-3184 - I'm sick of bugs getting stuck in my god damn bathroom light
- SCP-3185 - The Public Domain Protection Service
- SCP-3187 - Honu
- SCP-3188 - This Man Must Die
- SCP-3189 - For The Man Who Has Everything
- SCP-3191 - Consciousness Emulator
- SCP-3192 - When the Bell Tolls
- SCP-3193 - Christmas War
- SCP-3194 - Divine Presence
- SCP-3196 - The Adventures of Rex Dangerly
- SCP-3197 - A Trickster God for the Modern Age
3200-3299
- SCP-3202 - The Deeper End
- SCP-3203 - The Swiss Bank Account
- SCP-3204 - The Quantum Horse
- SCP-3205 - Adventure Tourist
- SCP-3206 - Who Wouldn't Want A Vomeronasal Organ?
- SCP-3207 - The Think-Tank
- SCP-3208 - YKHN
- SCP-3209 - Boredom Butterfly
- SCP-3210 - Alternative Facts
- SCP-3214 - Star Quality
- SCP-3215 - Delicious Anemone
- SCP-3217 - Mail "H" for "Hero".
- SCP-3218 - Animals in Boxes
- SCP-3219 - This Sour Earth
- SCP-3222 - A Very Real Pencil
- SCP-3223 - Ancient Egyptian Pet Whisperer
- SCP-3224 - Family Tree
- SCP-3225 - Dream for Ourselves Alone
- SCP-3226 - HEADBONES™!!
- SCP-3227 - Dart Frog Flora
- SCP-3228 - добрите стари дни
- SCP-3229 - A Blessed Sea
- SCP-3230 - Intergalactic Isolation
- SCP-3233 - Tenrec Goddess Reborn
- SCP-3234 - Pure Grey Static
- SCP-3235 - The Baba-disease
- SCP-3236 - All Those Fucking Ideas
- SCP-3239 - When Death Comes Calling
- SCP-3240 - The Bones Of What You Believe
- SCP-3241 - The SS Sommerfeld
- SCP-3242 - Operative Disease Mouse
- SCP-3243 - The Green Warden
- SCP-3244 - Mountain Dew: Code Red
- SCP-3245 - Mr. Playing Games Is Bad For Your Health
- SCP-3246 - A Nice Old Lady
- SCP-3247 - A Magic Mime and his Mighty Morphin' Method Acting Spider Kids
- SCP-3248 - Who Shot Sulley?
- SCP-3249 - Me, Us, Them, Them
- SCP-3250 - Jesus Fried Chicken
- SCP-3251 - The Coconut Crab Captain
- SCP-3252 - The Permian-Triassic Extinction Event
- SCP-3253 - A Prison of Ink and Flesh
- SCP-3255 - A Light Shining Through The Holes Inside Your Eyelids
- SCP-3256 - Web of Murder
- SCP-3257 - A Priest in a Suitcase at Timbuktu
- SCP-3258 - God Killers
- SCP-3259 - Verminous Ark
- SCP-3261 - The Dragon's Tongue
- SCP-3262 - Fire of Unknown Origin
- SCP-3263 - Mr. Headgeworth's School for the Magically Gifted
- SCP-3264 - Causeless Effect
- SCP-3265 - It's Good
- SCP-3266 - Time Loop in the Ardennes Forest
- SCP-3267 - Memories Bound in Paper
- SCP-3268 - Digital Predator
- SCP-3269 - Pop Culture
- SCP-3273 - Self-Performed Brain Editing Manual
- SCP-3274 - Nowhere Else To Run
- SCP-3275 - Excuse me, this is the wrong pizza.
- SCP-3277 - Speak Softly And Carry A Big Stick
- SCP-3279 - The Afterimage
- SCP-3281 - [REDACTED BY AARS538]
- SCP-3282 - The Worm of Your Dreams
- SCP-3283 - The biggest back yard in Boise
- SCP-3284 - Uncontainable
- SCP-3285 - creative comas
- SCP-3286 - Sea Legs
- SCP-3289 - Smile
- SCP-3291 - Flowers of Solomon
- SCP-3292 - The Land Before Time, For All of Time
- SCP-3295 - Thank You For Smoking
- SCP-3296 - The Drifter
- SCP-3297 - Gramma Always Remembers.
3300-3399
- SCP-3305 - The Father, The Son, and The Holy Toast
- SCP-3307 - Cornucopi-ass
- SCP-3308 - Crooked Excavator
- SCP-3309 - Where We Go When We Fade, Fade Away
- SCP-3310 - The Old Man of the Lake
- SCP-3311 - All the Little Chairs
- SCP-3313 - Poor Richard
- SCP-3315 - p e r s e v e r a n c e
- SCP-3317 - Libre la Livres
- SCP-3320 - Ethical Relativity
- SCP-3321 - Edge of the Universe
- SCP-3322 - Sister Cities
- SCP-3323 - R35urr3c710n
- SCP-3324 - Getting kidney stones in the past is more useful than you'd think
- SCP-3326 - The Threads of Fate
- SCP-3327 - Soviet Bunker(s)
- SCP-3328 - Where Dead Men Grow
- SCP-3329 - A Sucker Born Every Minute
- SCP-3330 - Études for the Universe
- SCP-3331 - With Apologies To John Cena
- SCP-3334 - Literally a Billion Memes
- SCP-3335 - The Hole in My Head Where My Mind Used to Be
- SCP-3336 - God Bless You
- SCP-3337 - Death Of The Artist
- SCP-3339 - Randall the Clown's Wacky Broadway Theatre
- SCP-3341 - Arabian Nasnas a.k.a. Somali Hungruf
- SCP-3342 - The Blackfoot Potato Transplants
- SCP-3343 - Beelzebub
- SCP-3345 - Crime Novel
- SCP-3346 - Worry Hat
- SCP-3347 - They Grow Up So Fast
- SCP-3348 - Lost Dictionary
- SCP-3349 - Printing EKG
- SCP-3350 - Shape Up!
- SCP-3352 - Bethlehem Steel
- SCP-3353 - Secrets for Sweets
- SCP-3354 - Killmotor Hill
- SCP-3355 - St. Nick
- SCP-3356 - The Unity of the Prokaryote
- SCP-3357 - Practice Makes Perfect
- SCP-3358 -
Anomaly ApartmentsSite-316 - SCP-3359 - The Dry Guy
- SCP-3360 - Proletariart, by San Francisco Jones
- SCP-3362 - A Forced Self-Insert
- SCP-3363 - The Citizen Kane of Lightning-induced Reality TV
- SCP-3364 - Time Static
- SCP-3365 - Lunar Module 16 ‘Phoenix’
- SCP-3366 - Man in Hole
- SCP-3367 - Prayers from Children, Eternally Answered
- SCP-3368 - Bees on the Brain
- SCP-3369 - A Living Joke
- SCP-3370 - Dead Air
- SCP-3371 - Beautiful Inside My Head Forever
- SCP-3372 - A Betrayer's Retribution and Quite the Earful
- SCP-3373 - Our Whole Universe was in a Hot Dense State
- SCP-3374 - Aquaria Phenomena
- SCP-3375 - Traveling Garden Eels
- SCP-3376 - The Dreaming Stone
- SCP-3378 - Info Drones
- SCP-3379 - D-11424 and the Arctic Meat Hole of Infinite Wonders
- SCP-3380 - Science, Technology, Engineering, Divinity
- SCP-3381 - Dream Studios
- SCP-3385 - The Last Voyage of the Far Horizon.
- SCP-3386 - Night Owls
- SCP-3387 - A Small World After All
- SCP-3389 - The Lake That Burns You
- SCP-3390 - A French Tank
- SCP-3391 - An Artificial God
- SCP-3392 - Euclid's Blackboard
- SCP-3394 - Brain Scientist
- SCP-3396 - The Empyrean Parasite
- SCP-3397 - Fortes Fortuna Iuvat!
- SCP-3398 - Hilbert's Grand Elevator
3400-3499
- SCP-3401 - Anyone Fancy A Cup Of Jade? Or maybe some Earl, or Jasmine?
- SCP-3402 - Rural Exodus Event
- SCP-3403 - Summer Dogs
- SCP-3404 - Down With the Sickness
- SCP-3407 - ¢10 Per Ticket
- SCP-3409 - The Chocolate Factory
- SCP-3410 - "It's just fucking golf!"
- SCP-3412 - Life in a Peaceful New World
- SCP-3413 - Irwin Shrugged
- SCP-3414 - Beware of Toilet Snake
- SCP-3415 - Employee of The Month, Every Month
- SCP-3416 - The Great Anoati!
- SCP-3417 - The Preachers of Globular Cluster Terzan 2
- SCP-3418 - Devourer of Flames
- SCP-3419 - Humants
- SCP-3420 - Too Many Ghosts
- SCP-3421 - Cell Phone Trees
- SCP-3423 - Inspirational Window
- SCP-3424 - Esto No Es Un Limón.
- SCP-3425 - The Joy of Creation
- SCP-3427 - Anatomical Civilization
- SCP-3428 - Buried Hummingbirds
- SCP-3429 - Just The Way It Is Now
- SCP-3430 - Baby Don’t Hurt Me...
- SCP-3431 - Refuse Koala
- SCP-3433 - I am a Deeply Superficial Person
- SCP-3435 - Analysis-Defying Dinosaur Painting
- SCP-3436 - ABE
- SCP-3438 - Recursive Romance
- SCP-3439 - A Postcard
- SCP-3440 - The Marvellously Macabre Mechanical Marionette Matinee
- SCP-3442 - Innovative and Synergistic Customer-Directed Actualization
- SCP-3444 - She Took The Midnight Train Going Anywhere...
- SCP-3445 - Grave Insights
- SCP-3446 - The Waders
- SCP-3449 - The Things Left Unsaid
- SCP-3451 - The Shade Closet
- SCP-3452 - Durendal
- SCP-3453 - The Juice is Loose
- SCP-3457 - The Rite of Solomon
- SCP-3458 - Bad Sectors
- SCP-3459 - Phobia Plague
- SCP-3460 - I'm Going to Change Your Life
- SCP-3461 - When The Saints Go Marching In
- SCP-3462 - Lights, Camera, REDACTION
- SCP-3463 - Flawless Objective Perception
- SCP-3464 - Olive Garden regularly communes with DEMONIC ENTITIES to summon their SATANIC sempiternal garlic bread
- SCP-3465 - Better Safe Than Sorry
- SCP-3466 - Only Birdbrains Live the American Dream
- SCP-3467 - Anomoaly
- SCP-3468 - Only YOU can prevent forest fires
- SCP-3469 - Nice Cream
- SCP-3471 - Paint Under the Bridge
- SCP-3472 - Mother Loves her Baby
- SCP-3473 - The Son of the Sun
- SCP-3474 - Grief Ignited
- SCP-3475 - Our Shifting Foundations
- SCP-3476 - A Place to Sever Stranded Heartstrings // Alex's Fountain
- SCP-3478 - A human-shaped hole to the meat dimension
- SCP-3479 - Proof We Are All As Angels
- SCP-3480 - Olympus Mons
- SCP-3481 - Glorious Sounds
- SCP-3482 - fine mayor posters campaign by dado
- SCP-3485 - Omega Messier
- SCP-3486 - Baby Mine
- SCP-3488 - Mimir, The Root Of All Knowledge
- SCP-3493 - The Great SCP Foundation Collaboration
- SCP-3495 - St. Brendan's Howler Monkey
- SCP-3496 - Can We Bee Friends?
- SCP-3497 - Backfiring Birds
- SCP-3498 - Monachopsis
- SCP-3499 - Please Stand By
3500-3599
- SCP-3500 - Instructions Unclear, Got Dick Stuck in Canon 🍆➡️📕
- SCP-3501 - The Storyteller of Isfahan
- SCP-3503 - Panic is Pure, Trauma is True, Suffering is Sweet, and Death's a Delight
- SCP-3504 - "And how will we know you are one of us?"
- SCP-3506 - The Reading of the Will
- SCP-3507 - Father, This Day I Bring You True Glory
- SCP-3508 - "Cute and soft! Kill them off!"
- SCP-3509 - The Test Chamber
- SCP-3510 - Not Another New World Order!
- SCP-3511 - Reach Out And Touch
- SCP-3514 - The Moment of the Mahdi and the Moment of the Mortal
- SCP-3517 - A Hideous Mountain
- SCP-3518 - Arctic Shrimp
- SCP-3520 - Fourteen Orangutans
- SCP-3522 - Black Body
- SCP-3523 - The Quarry
- SCP-3524 - You Cannot Contain Us
- SCP-3525 - A 5-Star Lyft Driver
- SCP-3526 - Ave, True to Caesar
- SCP-3529 - snake = snek = cute ^~^
- SCP-3530 - Shooting Star School
- SCP-3532 - Merch Link in Bio
- SCP-3533 - Metaphysiclean!
- SCP-3534 - Doomsyesterday
- SCP-3535 - Casus Lignum
- SCP-3538 - THE GREATEST CARABINER EVER
- SCP-3539 - So That Others May Live
- SCP-3540 - Don't Queer the Reaper
- SCP-3541 - Twice as Bright
- SCP-3542 - "Fear Not, Citizen!"
- SCP-3543 - One, Two, Four
- SCP-3544 - Home is Where the Heart Was
- SCP-3545 - The Places You'll Never Go
- SCP-3547 - A Dream of Our Beloved
- SCP-3548 - We exist, but only in your mind
- SCP-3549 - Sweet Medieval Bitcoin
- SCP-3550 - Cancer of Passion
- SCP-3551 - Dr. Wondertainment's Inflatable Invasion
- SCP-3553 - They All Go Into the Dark
- SCP-3554 - No. 4 Borscht Canning Factory
- SCP-3555 - Attempted Suicide
- SCP-3557 - CK or OK?
- SCP-3559 - Best Thing Since
- SCP-3563 - Lemonabe, 25¢!
- SCP-3564 - The Immortal Bard, Act Ⅱ: Return of Shakespeare
- SCP-3566 - Not Even That Funny
- SCP-3567 - Chrono-Wrap
- SCP-3568 - Shapes
- SCP-3569 - Buuny Butler
- EE-3570 - Umbral Ultimatum
- SCP-3571 - OLLIE'S OBSTACLE COURSE OF OBVIOUS OBLITERATION!
- SCP-3572 - Sand Cave
- SCP-3574 - Lambs to the Slaughter
- SCP-3575 - It's a Small Town
- SCP-3576 - Think But This And All Is Mended
- SCP-3577 - Pack To The Future
- SCP-3578 - A Mother's Love
- SCP-3579 - Insta-Gator
- SCP-3580 - The Devotion Locket
- SCP-3581 - Corneliu
- SCP-3582 - The Multiverse is Having a Seizure
- SCP-3583 - Hellbus
- SCP-3584 - Mechanical(?) Dandelion Garden
- SCP-3585 - Wondertainment's Murder Mystery Mates
- SCP-3588 - Cheers
- SCP-3590 - A Dirge for the Silent
- SCP-3591 - The Fallen Giant
- SCP-3592 - Kindertransport
- SCP-3593 - Scooby Snacker
- SCP-3594 - Genesis Ulcer
- SCP-3595 - Einheit
- SCP-3596 - Super Justice Containment Action Squadron
- SCP-3598 - Bishop's Glen Memorial Park
- SCP-3599 - A Hard Day at Work
3600-3699
- SCP-3600 - Documenting Doomsday
- SCP-3601 - A Cautionary Tale
- SCP-3602 - The Monkey King's Legacy
- SCP-3604 - Craydaddy
- SCP-3605 - The blue is so beautiful
- SCP-3606 - Praise You
- SCP-3607 - Residence Evil
- SCP-3608 - PTSD: Post-Traumatic Stress Dimension
- SCP-3609 - Hati Hróðvitnisson
- SCP-3611 - The Yamauchi Deck
- SCP-3612 - The Mainlist is Out of Order; Please Try Again
- SCP-3613 - Things You People Wouldn't Believe
- SCP-3614 - Your Reality
- SCP-3615 - Depressed Divine Demon of Diptera & Diarrhea
- SCP-3616 - Writer's Block
- SCP-3617 - The Parasites of Normal
- SCP-3618 - Supply and Demand
- SCP-3619 - You Spin Me Right Round, Baby, Right Round
- SCP-3620 - Data Expunged the Chicken
- SCP-3621 - Best Intentions
- SCP-3622 - Agile, Handle with Care
- SCP-3623 - She was my muse
- SCP-3624 - Crazy Chimera Lady
- SCP-3625 - The Great American Meme Machine
- SCP-3627 - Dreamy Jasters
- SCP-3628 - Better Not to Know
- SCP-3629 - Spinder
- SCP-3630 - Reverse Locked Room Mystery
- SCP-3631 - A Man and his Monster
- SCP-3632 - Nibirdu
- SCP-3634 - In Vino Veritas
- SCP-3635 - The Forgotten Archive
- SCP-3636 - World's Greatest Jukebox
- SCP-3638 - You can't be serious!
- SCP-3639 - What-A-Boots
- SCP-3641 - Remember
Apollo-99Nased - SCP-3642 - T(r)opical Cream
- SCP-3643 - Part 1: ANOMALY IS THE MOST DANGEROUS ANIMAL
- SCP-3644 - Slot reserved, please do not fill
- SCP-3645 - Star Child
- SCP-3646 - Phantom Mosquitos
- SCP-3647 - Quousque Tandem?
- SCP-3648 - Buga and Buninka
- SCP-3650 - Travel Bug
- SCP-3651 - Chalk Children
- SCP-3652 - Inverting Box
- SCP-3653 - A Calendar with Extra Days
- SCP-3654 - WarTime
- SCP-3655 - The Last Resort
- SCP-3656 - Governments in Exile
- SCP-3657 - Posthumous Hero
- SCP-3658 - The Time Walker
- SCP-3659 - Rubbery Triceratops Gauntlet
- SCP-3660 - The Zoo Zipper (https://scpfoundation.net/sandbox:scp-3660)
- SCP-3661 - A Toy Story
- SCP-3662 - The Doomsday Clock
- SCP-3665 - Instant Demon, Just Add Blood!
- SCP-3666 - Repairing the Mask
- SCP-3667 - All's Well that Ends Hell
- SCP-3668 - Provenance
- SCP-3669 - A Mathematics Self Help Book
- SCP-3672 - Why are there so many songs about rainbows?
- SCP-3673 - But when the door is closed…
- SCP-3674 - The Loss of Sector H
- SCP-3675 - The Void Called
- SCP-3676 - The Multiversal Megapede
- SCP-3677 - Paradix High School: Paradise for the Paranormal
- SCP-3678 - "It's Not That Anomalous."
- SCP-3679 - Make a Geas, Foundation
- SCP-3680 - The White Guys
- SCP-3681 - 5 - 0
- SCP-3682 - Parousia
- SCP-3683 - Dire Pigeons
- SCP-3684 - Pump You Full Of Lead
- SCP-3685 - The Fractured Pile
- SCP-3686 - Evan Deserves to be Remembered
- SCP-3687 - Anti-Entropy Doorknobs
- SCP-3690 - Abdominal Pains
- SCP-3691 - Medium Rare
- SCP-3692 - the notebook
- SCP-3694 - America's Diner Is Always Open
- SCP-3697 - "Let Me Redirect You Right Now"
- SCP-3698 - Fresh Pine
- SCP-3699 - Memoirs of a Shingle Beach
3700-3799
- SCP-3701 - All the Time in the World
- SCP-3703 - From Death, We Contain
- SCP-3704 - Requiem
- SCP-3705 - The Gardener's Shadow
- SCP-3706 - 50,000 Krakens Under the Sea
- SCP-3709 - Intended Purpose
- SCP-3710 - Elon MUSH!
- SCP-3711 - Suffering On The Rising Tide
- SCP-3712 - Grandma Knows Best
- SCP-3713 - All the World’s a Stage
- SCP-3714 - Jiangshi's Ring
- SCP-3715 - Not So Subtlє Teα
- SCP-3716 - Boned Beyond Belief
- SCP-3718 - An Environmental Cat-astrophe
- SCP-3719 - Your Friendly Neighbourhood Lawnmower
- SCP-3720 - Smiting on a Budget
- SCP-3721 - Obsolete Weapons System
- SCP-3722 - The City That Was Half the World
- SCP-3723 - The Orca-stra
- SCP-3724 - Guard Puppies
- SCP-3725 - Ironically, I don't have a Good Idea for a Title
- SCP-3726 - AnthropomorFic
- SCP-3727 - Syringe Man
- SCP-3728 - STOP. HAMMERTIME
- SCP-3729 - The Best Day of Your Life
- SCP-3731 - Normality Will Be Protected
- SCP-3734 - Muddy Morphing Power Worms!
- SCP-3735 - ForbiddeN SouNd
- SCP-3736 - Talk It!
- SCP-3738 - Casting Lots
- SCP-3739 - Mind-Milk™ by Moosphere, Inc.
- SCP-3741 - The World Is Your Oyster
- SCP-3742 - A "Live" Album
- SCP-3743 - Euboea, Son of Briareos
- SCP-3744 - Dungeons And D-Class Personnel
- SCP-3745 - As the Heart Breaks, so do the Heavens
- SCP-3747 - Death by Vacuum
- SCP-3748 - Bowl of Flies
- SCP-3750 - A White Fish
- SCP-3751 - Skip's Gambit
- SCP-3752 - Cold From Within
- SCP-3753 - TEA-K.O.
- SCP-3754 - Pocket Pet Collector Plus!
- SCP-3755 - Guess How Many
- SCP-3756 - In Space, No One Can Hear Yee-haw!
- SCP-3757 - Cocoon Park
- SCP-3758 - The Last Dodo
- SCP-3761 - The War of the Squirrels
- SCP-3762 - Shelter from the Storm
- SCP-3763 - A Piece of Him is Still Around
- SCP-3766 - Reverse Cargo Cult
- SCP-3767 - Additional Baggage Fee
- SCP-3768 - Three Moons Public Radio
- SCP-3769 - Evolutionary Rescission Device
- SCP-3770 - One Thousand Footsteps Towards The Promised Land
- SCP-3771 - Americans Be Eating Cheesed Burger
- SCP-3772 - 😂 WHO DID THIS 😂
- SCP-3773 - 9,000 Lives
- SCP-3774 - My Heart DEETs Faster For You
- SCP-3776 - Camp Nimrod
- SCP-3778 - We Are Possum. We Are Legion.
- SCP-3779 - A Greenhouse: Or, How D-80801 Learned To Give In And Embrace Nature
- SCP-3781 - OK ペインター!
- SCP-3782 - Through Roosevelt's Glasses
- SCP-3783 - Baba Yaga's Cottage
- SCP-3784 - High Octane Nightmare Fuel
- SCP-3785 - Jasper's Hill
- SCP-3786 - Chubby Dog
- SCP-3787 - The Horse Meme
- SCP-3791 - An Entirely Standard and Uneventful Anomaly
- SCP-3792 - Up In Smoke
- SCP-3793 - Spectral Punk Drive-By
- SCP-3798 - There Are Flowers There
3800-3899
- SCP-3800 - Many Grandparents Ago
- SCP-3801 - Based on a True Story
- SCP-3803 - Custom-Made Business Cards, On the Go!
- SCP-3804 - Communiqués from the Apocalypse
- SCP-3805 - The Birth Of The World
- SCP-3807 - A Real Bad Hombre
- SCP-3809 - Love in the Time of Algorithms
- SCP-3810 - [UNTITLED]
- SCP-3811 - A Therapist Needs A Therapist
- SCP-3814 - Tag! You're it!
- SCP-3816 - Blue Light
- SCP-3818 - Two Favours One
- SCP-3819 - Box of Desire
- SCP-3820 - Sitting and Caring for Pets
- SCP-3821 - Stuck In the Mailroom
- SCP-3822 - K-PARTY
- SCP-3823 - Put On Your Red Shoes
- SCP-3825 - So it Goes
- SCP-3826 - The Definition of Technophobia
- SCP-3828 - A Powerful Seal
- SCP-3829 - Metastasis
- SCP-3831 - Can't Call Out
- SCP-3832 - Surprise Pillow Fight
- SCP-3834 - Fossil Records
- SCP-3835 - Better inWeedients, Better Pizza, Papa John's
- SCP-3836 - Grease Monkey And The Search For FAST
- SCP-3837 - Corn Goblin
- SCP-3838 - Nomads of the 4th-Dimensional Steppe
- SCP-3839 - Liposlugtion: 2 Fat 2 Furious
- SCP-3843 - Sam
- SCP-3845 - Buddy
- SCP-3846 - Walden Pond Scum
- SCP-3848 - History Exists for the Memorable
- SCP-3851 - You May Not Be Able To Drown Your Demons, But The Demons Can Drown Your Screams
- SCP-3852 - Small Town Justice
- SCP-3853 - Imperium
- SCP-3854 - Belly of the Playwright
- SCP-3857 - Call of the Tropic
- SCP-3858 - Hugbox
- SCP-3861 - Self-Reflection
- SCP-3864 - I've Been Framed!
- SCP-3865 - You Reap What You Sow
- SCP-3868 - Constitution Saving Throw
- SCP-3869 - High Quality Ripoff
- SCP-3870 - The Ice-Cream Vigilante
- SCP-3871 - Dr. Wondertainment's Allegorical Anomaly-Annihilating Assault Automaton
- SCP-3872 - Consult an Alchemist
- SCP-3873 - Unbearable Treatment
- SCP-3875 - Spyders
- SCP-3876 - Tussie Mussie
- SCP-3877 - MIЯЯOЯ BÄR
- SCP-3879 - Musical Jolly Ape™ by Dr. Wondertainment
- SCP-3880 - ILLEST RAIN SOUNDS ∞ Hours No Looping - White Noise, Nature/Healing/Ambient, Meditation/Insomnia/Study ASMR [ORIGINAL]
- SCP-3884 - Gunmetal Gary Puts the Peddle to the Metal
- SCP-3885 - The High-Octane Full-Throttle Adventures of the Exploding Zombie Gearheads
- SCP-3886 - The Necromancer’s Saddle
- SCP-3887 - Monster under the bed
- SCP-3889 - The Greatest Fisherman Who Ever Lived
- SCP-3891 - Paradise Lost and Found
- SCP-3893 - I'm Going to Have a Motherfucking Meltdown
- SCP-3894 - Our Sorrow
- SCP-3895 - Our Unrest
- SCP-3896 - We'll Never Stop Eating Big Gordo
- SCP-3897 - Mother's Eye Is Upon You
- SCP-3898 - The Burden
3900-3999
- SCP-3909 - Wu Tang Clan Ain't Nuthing ta Fuck To
- SCP-3910 - A Comedy
- SCP-3912 - Final Memories Through The Lens
- SCP-3914 - Necrocapitalism
- SCP-3915 - Gay Trashman
- SCP-3916 - Hungry Locusts
- SCP-3917 - Beetles in a Jar
- SCP-3918 - To Starve Her Highness
- SCP-3919 - In Memoriam
- SCP-3921 - Greco-Roman Atmospheric Reconstruction
- SCP-3923 - Negotium Ficus
- SCP-3924 - Silent Honour Ark
- SCP-3925 - It's All Papers and Forms
- SCP-3926 - Saturday Evenings with your host, Tyal'k'nec!
- SCP-3927 - The Fancy Mouse
- SCP-3928 - Eliphalet Remington Can Kiss My Ass
- SCP-3931 - The End of Days
- SCP-3935 - This Thing a Quiet Madness Made
- SCP-3938 - Dr. Wondertainment's Take-You-Anywhere Machine
- SCP-3939 - [NUMBER RESERVED; AWAITING RESEARCHER]
- SCP-3941 - The Major Occultation
- SCP-3943 - Taco Man
- SCP-3944 - Memory Is Fleeting
- SCP-3945 - Big Huge Nightmare Panther
- SCP-3946 - Amphitrite's Curse, Scylla's Wrath
- SCP-3948 - The Man in the Mirror
- SCP-3950 - FULL THROTTLE AXOLOTL
- SCP-3951 - Doggone It
- SCP-3954 - Scarecrow's Secrets
- SCP-3956 - The Mealworm Song
- SCP-3957 - The Eternal Soviet Prison
- SCP-3958 - Little Brother
- SCP-3959 - The End of All Knowledge
- SCP-3962 - Agasesdi's Gift
- SCP-3963 - I Contain Multitudes
- SCP-3964 - Suicide Staircase
- SCP-3965 - Zhulong
- SCP-3967 - All Watched Over By A Machine Of Loving Grace
- SCP-3968 - Immoral Minefield
- SCP-3969 - Hofmann's Nightmare
- SCP-3970 - i want to contain too
- SCP-3971 - Utility Closet SB3-117a
- SCP-3972 - "Ken Burns Presents: SCP-3972"
- SCP-3973 - Would you like to re-roll?
- SCP-3974 - Such Sweet Sorrow
- SCP-3975 - Save the Oreos
- SCP-3977 - Hawaiian Punch
- SCP-3978 - The World Is Going Away
- SCP-3981 - [UNTITLED UFO]
- SCP-3982 - The Devourer of Filth Would Like to Be Friends With You
- SCP-3983 - To Petition the Dead
- SCP-3985 - Focus of a Regulatory Dispute
- SCP-3986 - The Observatory of Genghis Khan
- SCP-3987 - Purifying Exclamation
- SCP-3988 - Napoleon Bonyparts, Superstar Skeleton
- SCP-3989 - The Bone Orchard
- SCP-3990 - Deer in the Headroom
- SCP-3991 - "Lewis Island"
- SCP-3992 - Wondertainment Whacky Halloween Fun Masks!
- SCP-3993 - Smart WIFI
- SCP-3994 - Normal Human People
- SCP-3996 - The Tangential Frontier
- SCP-3997 - In My End Is My Beginning
Фрагмент списка для редактирования
Содержание
4000-4099
4100-4199
4200-4299
4300-4399
4400-4499
4500-4599
4600-4699
4700-4799
4800-4899
4900-4999
4000-4099
- SCP-4004 - A Dream Come True
- SCP-4005 - The Holy and Heavenly City of Fabled China
- SCP-4009 - Big Brozart is Watching You
- SCP-4013 - It Can't Be Allowed To Stop
- SCP-4015 - The Keepers
- SCP-4016 - Of Mice and Twine
- SCP-4018 - Eye
- SCP-4020 - It Won't Stop Screaming
- SCP-4021 - Mandarin Oranges
- SCP-4023 - The Inexplainable Nature of Twenty Three
- SCP-4025 - Blutfahne
- SCP-4027 - Anomalous Dissociative Identity
- SCP-4029 - Too Many Legs to be Going Nowhere
- SCP-4030 - It Wants to be Free
- SCP-4032 - Deadly Fart Berries
- SCP-4034 - Defenetre of the Strate
- SCP-4035 - Prey on Words
- SCP-4036 - The Republic
- SCP-4037 - One of Mind
- SCP-4038 - The Common Tongue
- SCP-4039 - The Second Second Law of Thermodynamics
- SCP-4042 - Somebody to Love
- SCP-4043 - Gaia
- SCP-4044 - A Reprieve
- SCP-4047 - Abstract Art
- SCP-4048 - We need to talk about your forklift certification
- SCP-4049 - Beast Pits
- SCP-4051 - Your Friendly Neighborhood Keter
- SCP-4052 - Sandwich (disambiguation)
- SCP-4053 - The Gift of Life
- SCP-4055 - Three Split Seconds
- SCP-4056 - Nuclear Family Unit
- SCP-4058 - We Become Stories That Are Dying To Be Told
- SCP-4059 - The Jersey Devil
- SCP-4061 - Unphotographable
- SCP-4063 - What Remains
- SCP-4064 - "It's not you, it's us"
- SCP-4066 - The Byzantine Empire Was Secretly Aliens
- SCP-4067 - Effigies From The Swarm
- SCP-4068 - Buzzword
- SCP-4069 - Out of Range
- SCP-4071 - History Rewritten
- SCP-4073
N- Just Blowing Hot Air - SCP-4074 - Sun Flower
- SCP-4075 - Birds of a Feather
- SCP-4076 - Video Hurt System
- SCP-4077 - City of Gold
- SCP-4078 - Neo-Lamarckian Genetic Engineering
- SCP-4079 - Saving Archimedes
- SCP-4081 - Audition Interference
- SCP-4082 - NeoVancouver Free Radio
- SCP-4083 - Lakeside View Apartments
- SCP-4084 - Then Who Was Phone?
- SCP-4085 - What business, nay?
- SCP-4086 - The Tunnels
- SCP-4090 - The Dream of the Anartist's Son
- SCP-4091 - A Boy's Dog
- SCP-4092 - Rubber Stepdad
- SCP-4094 - They Hunger Beneath the Ice
- SCP-4097 - Louder Than God's Revolver And Twice As Anomalous
4100-4199
- SCP-4101 - The World's Greatest Teacher is History
- SCP-4102 - I Have a Bridge to Sell You
- SCP-4103 - Holiday in Hell
- SCP-4104 -
He’s lying to you all. - SCP-4105 - They Came From the River
- SCP-4106 - The Love Bird
- SCP-4108 - Not Really a Catapult
- SCP-4109 -
FINAL CONCLUSION: EVERYTHING IS TERRIBLE - SCP-4110 - The Ultimate Cosplay
- SCP-4111 - Straight From the Horse's Mouth, and Into the Fire
- SCP-4112 - We Have Assumed Control
- SCP-4113 - Long is the Way You Must Wander
- SCP-4114 - Occult Escapologist
- SCP-4115 - Beast of the Crystal Caves
- SCP-4116 - The Nightmare King in The Palace of Dreams
- SCP-4117 - Mannequins of a Table
- SCP-4118 - Tube O' Dinos
- SCP-4119 - Miss Dynamite
- SCP-4121 - The Loop That Never Breaks/Never Has/Never Will Be Broken
- SCP-4122 - The Second-long Pipe
- SCP-4123 - Gamemaster
- SCP-4124 - Friendship is fleeting, Trauma is forever.
- SCP-4125 - Revenimus
- SCP-4126 - The Bedsheet Ghost
- SCP-4128 - Action Comics #1
- SCP-4129 - For Here or To-Go?
- SCP-4130 - Su Alteza Serenísima
- SCP-4131 - Gunhead Anomalocaris, Trilobite Slayer!
- SCP-4132 - Retrochronal Observation Tank
- SCP-4133 - The Pinup That Doesn't Exist
- SCP-4134 - Claymore Anti-Personnel Mimes
- SCP-4137 - Hyper-Axial Nintendocore Overdose
- SCP-4138 - To the Stars
- SCP-4139 - Fridge Backpack
- SCP-4140 - Sarkic Containment Procedures
- SCP-4141 - "You: The Real-Time Autobiography"
- SCP-4143 - Infinitestine
- SCP-4144 - The Most Important Meal Of The Day
- SCP-4145 - Dissociative Dream Therapy™
- SCP-4147 - Encyclopedia Obscura
- SCP-4149 - Professor Xorkanoff's Gallery of the Bizz-art
- SCP-4150 - Beatlemania!
- SCP-4151 - The Garden of Gluttony
- SCP-4152 - BASEMENT LOVE, Acrylic on canvas
- SCP-4153 - Vincent Price presents... IT CAME FROM SITE-9!
- SCP-4154 - Petwyrm
- SCP-4155 - Soft Serve Kittens
- SCP-4159 - Oh God Something Touched My Leg
- SCP-4160 - Those Who Don't Learn From History
- SCP-4161 - METEMPSYCHOSIS.
- SCP-4162 - An Egg That Kills You For No Reason
- SCP-4163 - The Tetris Prodigy
- SCP-4164 - The Universal Instruction Manual
- SCP-4167 - Heterophyes neurensis
- SCP-4168 - Decomposing Love
- SCP-4169 - Carbonized Purgatory
- SCP-4170 - The Dark
- SCP-4172 - The Artist
- SCP-4173 - The House on Hadley Hill
- SCP-4174 - Mother of Many
- SCP-4175 - Friends Made, and the Void
- SCP-4178 - Arachnespheksophobia
- SCP-4179 - Milestones
- SCP-4180 - Tomorrowland
- SCP-4181 - Spatuland
- SCP-4184 - Threnody, Requiem, Dirge
- SCP-4185 - we outrun yourself
- SCP-4186 - Postcards From Italy
- SCP-4187 - Bu(r)g(er) King
- SCP-4188 - What Dreams May Come
- SCP-4189 - Vengeful Assimilation Coral
- SCP-4191 - Draco ignem
- SCP-4196 - Daughter of the Confederacy
- SCP-4197 - Hollow
- SCP-4198 - Feed Your Hair
- SCP-4199 - An Average Joe
4200-4299
- SCP-4200 - The World, Idealized
- SCP-4202 - The Sleepy Clapper
- SCP-4203 - Sometimes a Damselfly Just Wants Some Dick
- SCP-4204 - To Pluck the Moon From the Sky
- SCP-4207 - Auditory Entity
- SCP-4208 - Naomi’s Sweetery
- SCP-4209 - Egg-Cellent Boys!
- SCP-4210 - The American Dream
- SCP-4211 - Memoirmento
- SCP-4212 - A Very Helpful and Clearly-Written SCP Report
- SCP-4214 - commission request for advertisement of product (c.r.a.p.)
- SCP-4215 - The Inkredible 51st Squiddy Squaddy
- SCP-4219 - LUDROA
- SCP-4221 - What A Wonderful World
- SCP-4222 - International Monetary Fish
- SCP-4223 - The Baja BlastTM
- SCP-4224 - History Will Be Kind To Me
- SCP-4226 - The Spring of the Ages
- SCP-4227 - Where lost things go...
- SCP-4229 - Mother's Gift
- SCP-4230 - The Redacted Fanon wiki
- SCP-4231 - The Montauk House
- SCP-4232 - Thought Crustacean
- SCP-4233 - The Dreadnought
- SCP-4234 - Testicles, and the Sudden Lack Thereof
- SCP-4235 - Rosa aeternum
- SCP-4236 - It's the End of the World (And Everyone Feels Fine)
- SCP-4237 - Where Winter Rests
- SCP-ℸp♡9 - or, KTE-6561-Black, or, dolphinslugchugger and scarhaver's GAW-1 proposal, or, 8008132, or, Our Friend Who Lives By The Lake, or, The Lake, or, A Very Important Question, or, The Reason We Did Something New This Time, or, Go Big or Go Home
- SCP-4242 - Foundations
- SCP-4243 - Celltown
- SCP-4244 - Good Taste In Musicians
- SCP-4245 - BellyFlopology
- SCP-4246 - Thalassomania, or The Dreams of the Firstborn
- SCP-4248 - Alphabet and Omega
- SCP-4249 - Nothing Really Mattress Anymore, or: Zen And The Art of Hunting Free-Range Furniture
- SCP-4250 - Colorful Pens With Thematic Ends
- SCP-4252 - Beans and Betrayal
- SCP-4253 - The Drowned
- SCP-4254 - Elvis?
- SCP-4255 - Santa Claus, The Time Traveler
- SCP-4256 - Bootlegger's Press
- SCP-4258 - Freddy's Diner
- SCP-4260 - The Subdirective
- SCP-4261 - In Case of Emergency, Blow Shofar
- SCP-4262 - The Essential Thing Is Not To Have Conquered But To Have Fought Well
- SCP-4263 - Gemini
- SCP-4265 - Filmographer Snake
- SCP-4266 - The Thing That Makes You Kill People
- SCP-4267 - Down With The Flue
- SCP-4268 - Eviction
- SCP-4269 - Fuck With The Lights Turned-On
- SCP-4270 - Does Benjamin Harrison Shit In The Oval Office?
- SCP-4271 - Silicon Valley
- SCP-4272 - The Proper Way to Appreciate Art
- SCP-4273 - Designated Successor
- SCP-4275 - The Old Man of the Sea
- SCP-4276 - Dance Till You're Dead
- SCP-4277 - Bullet Farm
- SCP-4278 - The Island at the End
- SCP-4279 - A Toast to my Finished Thesis
- SCP-4280 - The Inter-Dimensional Insult Punishment Jar™
- SCP-4281 - Stalled Conversation
- SCP-4282 - Mutiny's Bane
- SCP-4283 - Heart of Ouachita
- SCP-4284 - Walker Towers
- SCP-4285 - Dank Memetics
- SCP-4287 - P. Pigeon, Esq.
- SCP-4289 - The Bunyip
- SCP-4291 - The Little Death
- SCP-4292 - "herbie fucker really very good circus of the unsettle by dado"
- SCP-4293 - In One Man’s Honour, A Dossier Of unBÄRable Solitude
- SCP-4294 - In the Cold Shadow of her Ovary Tower
- SCP-4295 - A Homebody
- SCP-4297 - The Emu-lution of War
- SCP-4298 - Cell Door #546 or Site-446's Paradox
- SCP-4299 - I See Life in Rosy Hues
4300-4399
- SCP-4300 - To Lose One's Soul
- SCP-4301 - Timothy Gilles
- SCP-4302 - Prior Predator
- SCP-4303 - Wild Rose
- SCP-4304 - There Is No Honor Among Thieves (Even When Mechas Are Involved)
- SCP-4305 - No Lifeguard On Duty
- SCP-4306 - Stan the Janitor
- SCP-4307 - Electro-Marine Praetorian
- SCP-4308 - Heartfelt
- SCP-4309 - Huddle with Us
- SCP-4312 - Drift Into the Sky
- SCP-4315 - S.C.P. Lovecraft
- SCP-4317 - Catscratch
- SCP-4318 - A HORRIFIC, DEADLY, EVIL Chemical [BEWARE]
- SCP-4320 - Show Me The Glint of Light on Broken Glass
- SCP-4321 - Sometimes I Look At The Sky So I Can Feel Small
- SCP-4323 - Touch
- SCP-4324 - Saint Torben the Strange
- SCP-4325 - NO SIGNAL
- SCP-4326 - Honeymooners
- SCP-4327 - Suppressive fire in, suppressive fire out! Do the hokey-pokey and that's what it's all about!
- SCP-4328 - Sinew and Cellulose
- SCP-4329 - [ACCESS DENIED]
- SCP-4331 - When Good Elk Go to War
- SCP-4333 - The Profligate
- SCP-4338 - Vulcan, the Disaster
- SCP-4341 - Unimal Life
- SCP-4343 - You Will Be Free
- SCP-4345 - Not your Home, not your Pain, not your Self.
- SCP-4346 - Searching for Friends in a Room Full of Loneliness
- SCP-4347 - Goat of Departure
- SCP-4349 - ...But I Play One On TV
- SCP-4350 - I See Yellow People
- SCP-4351 - Home
- SCP-4353 - Your 223rd First Day
- SCP-4354 - From The Ink Under Your Skin To Flesh
- SCP-4355 - OZYMANDIAS, KING OF KINGS
- SCP-4356 - The Not-Quite-Broken-Clock Affair
- SCP-4357 - Slimelord
- SCP-4358 - An Undying Love
- SCP-4359 - Sash Lantern
- SCP-4361 - Red is Her Favorite Color
- SCP-4362 - Achilles Defense Systems
- SCP-4363 - Wake Me Up, I'm Living a Nightmare
- SCP-4365 - Five-Story Upside-Down Hotel
- SCP-4366 - Invisi-Birds
- SCP-4367 - What Are The Odds?
- SCP-4368 - To Sleep, Perchance to See
- SCP-4369 - Cassandra: Play Your Part
- SCP-4370 - POST-INDUSTRIAL
- SCP-4371 - Lee and Skorzeny, in the Apennines
- SCP-4372 - So Very Small, So Very Safe
- SCP-4373 - Drown
- SCP-4374 - This Is You
- SCP-4375 - Two Forgetful Men
- SCP-4376 - Have you tried just smiling more?
- SCP-4377 - Fight! Fight for the Man of the People!
- SCP-4378 - Her Noodly Appendage
- SCP-4379 - New Sun Will Rise, and Shadows Quickly Fade
- SCP-4381 - Moccus Meme
- SCP-4382 - Entropic of Hulwick
- SCP-4383 - Sticks and Stones, Blood for Old Bones, a Curse Forever Thirsty.
- SCP-4385 - Dimensional Phone Line
- SCP-4386 - B Gone, B
- SCP-4387 - Don´t lose your head, comrade
- SCP-4388 - Rampant OSHA violations
- SCP-4389 - Big Ol' Eyebrows
- SCP-4390 - A Bad Maze
- SCP-4392 - Sandpit
- SCP-4393 - The Beating Sounds of a Thousand Paper Wings
- SCP-4394 - Liquid Piano
- SCP-4395 - That Contagious Thing
- SCP-4396 - The Joy of Completion
- SCP-4397 - Medila's Altar
- SCP-4398 - Distant Triangles of Energy
4400-4499
- SCP-4400 - This Is Not A Place of Honor
- SCP-4401 - Total Eclipse Of The Heart
- SCP-4402 - The Permanent Shopping List
- SCP-4403 - The Silent Crusade
- SCP-4404 - The Scent of Silence
- SCP-4406 - SUDDEN THUNDER
- SCP-4407 - "TelaV, the Punishing Demon"
- SCP-4408 - It's not the Foundation that he's afraid of.
- SCP-4409 - The Elephant Man
- SCP-4410 - The Ongoing Development of an Art Form
- SCP-4411 - At Long Last Landing
- SCP-4412 - What Could Have Been?
- SCP-4413 - The End of Something Really Excellent
- SCP-4414 - "PEEL"
- SCP-4415 - Humanoid Containment Chamber #λ045
- SCP-4416 - Tails of Site-42: Why The Foundation Punches Sharks
- SCP-4417 - The Long Way Round
- SCP-4418 - The Lovers
- SCP-4421 - Papa Legba's Walkin' Stick
- SCP-4422 - O Tempestas, O Mores
- SCP-4423 - StepDemon
- SCP-4424 - The Train With No Final Station
- SCP-4425 - Chef Arkady's Canned Surprise!
- SCP-4426 - The Unforgettable Fire
- SCP-4427 - Nobody Stands for the People
- SCP-4429 - William Shatner's Cover of "Common People"
- SCP-4431 - Bleeding Beneath Antarctica
- SCP-4433 - Suburban Nightmare
- SCP-4434 - Anglerfish
- SCP-4435 - Sins of the Father
- SCP-4436 - Jesus Saves
- SCP-4437 - NANI?! MULTI TIMELINE DRIFTING?!?
- SCP-4438 - FOURTH
- SCP-4439 - The Weeping Child
- SCP-4440 - IT'S NERF OR (___)
- SCP-4441 - Summer Scare
- SCP-4442 - How's My Driving?
- SCP-4444 - Bush v. Gore
- SCP-4445 - The Day the Music Died
- SCP-4447 - Sasha's Super Shuttle Service!
- SCP-4448 - The Elk in the Lake
- SCP-4452 - Submitted to the Ethics Committee for review
- SCP-4453 - Wholesome Family Goddess
- SCP-4454 - Looking For Someone To See The World With
- SCP-4455 - In Short...
- SCP-4457 - Assopods
- SCP-4458 - jaws is gonna get ya
- SCP-4460 - Humorous Factory
- SCP-4461 - lonely at the bottom, innit
- SCP-4462 - Fan Death
- SCP-4463 - Ecosystem Restore Point
- SCP-4466 - Why the Long Face?
- SCP-4468 - Take-a-Wish
- SCP-4469 - Memory Shovel
- SCP-4470 - Endure
- SCP-4471 - Hoard
- SCP-4472 - Auger
- SCP-4475 - So Long, and Thanks for All the Milk
- SCP-4476 - La Famille Natau
- SCP-4477 - Leave Room for Jesus!
- SCP-4479 - D-11424 and The Land of Too Many Doors
- SCP-4480 - The Snake Doctor
- SCP-4481 - A Casualty of the Single Worst Astronautical Disaster in History
- SCP-4482 - Last Call
- SCP-4483 - Cut off the Head
- SCP-4484 - StreamSavers
- SCP-4485 - Такой чёрный свет (статья ранее была переведена, старый текст находится ссылке, статья была плохо реализована технически и удалена)
- SCP-4486 - Happy Is Relative
- SCP-4487 - The Sermon Will Continue
- SCP-4489 - Apologies
- SCP-4490 - Cruel To Be Kind
- SCP-4491 - "pulp ficktion"
- SCP-4492 - Umbrella In The Toilet
- SCP-4493 - Keep Pride Out of Corps
- SCP-4495 - A God for Pigs
- SCP-4496 - Gold Plastic Syndrome (Infectious)
- SCP-4497 - Whose Cuisine Reigns Supreme?!
- SCP-4498 - The Plurality of Jack Bright
- SCP-4499 - YES, ONLY $44.99!
4500-4599
- SCP-4501 - At The Mountains Of Minty Freshness
- SCP-4502 - Emily The Eldritch Ergot Goddess & Friends
- SCP-4504 - The Handless Man
- SCP-4505 - A Brief History of Anomalous Artwork in the Renaissance
- SCP-4506 - Eternal Child Star
- SCP-4507 - The Solitary Path to Enlightenment
- SCP-4509 - Lovers' Lane
- SCP-4510 - Avelar Express First Class Prime™!
- SCP-4512 - A Goddamn Filthy Teleporting Party Pool
- SCP-4513 - Pounded in the Butt with Moby Dick by my IRS W-2 Tax Form
- SCP-4515 - Why is the Sky?
- SCP-4516 - Don't fuck with hyper-religious cats
- SCP-4518 - MBMBMBMBMBMBMBaM
- SCP-4519 - Carl Sagan, Godhead
- SCP-4520 - Alea Iacta Est
- SCP-4522 - The Mystical Village of the Jade Peach
- SCP-4523 - Cave Story
- SCP-4524 - A Flesh, New World
- SCP-4526 - I'm Her Union Rep, Jimmy No-Last-Name
- SCP-4527 - Crippling Indecision
- SCP-4528 - Accendium Lucia
- SCP-4529 - A Walk in the Park
- SCP-4530 - And Into The Woods We Go
- SCP-4531 - Silence encourages the tormentor, never the tormented.
- SCP-4532 - Wire Transfer
- SCP-4533 - Terms and Conditions Apply
- SCP-4535 - The Better Man
- SCP-4536 - The Great American Pyramid
- SCP-4537 - Artist's Syndrome
- SCP-4538 - Flash! Bam! Alakazam!
- SCP-4539 - The Worst Calculator Ever
- SCP-4540 - History, Together
- SCP-4541 - A Toy Story
- SCP-4542 - Bug Bunnies
- SCP-4543 - Dead Men Sell No Sales
- SCP-4544 - The Circumventing Shoe Box
- SCP-4549 - Retrohippies
- SCP-4550 - An Operational Foundation Site
- SCP-4551 - Bell for a Funeral...
- SCP-4552 - Auguries of Innocence
- SCP-4553 - Bob Shepherd, Anthropomorphic Mass of Worms and United States Representative of the 3rd Congressional District of Nebraska
- SCP-4554 - Liquid Sunshine
- SCP-4556 - Belonging
- SCP-4557 - Detective Fiver, Crime Solving Raccoons
- SCP-4560 - Everything is Fine
- SCP-4562 - Melody of your life
- SCP-4563 - Doctor Barnabas P. Lockwood, MD.
- SCP-4564 - Butthole Surfers
- SCP-4566 - The Mark of Xerrox
- SCP-4567 - Biological Oil Platforms
- SCP-4569 - Plot Twist
- SCP-4570 - Almost Heaven, West Virginia
- SCP-4571 - Curious Creature of the Cold Red Desert
- SCP-4572 - Trumpvoid
- SCP-4573 - ULTRA TASTE
- SCP-4574 - Paleolithic Spear Tigers
- SCP-4575 - Seemingly Unconnected Events
- SCP-4576 - Protective Prickly Pal, Prixors
- SCP-4577 - When I'm dead, just throw me in the trash
- SCP-4579 - Quack-stral Projection
- SCP-4580 - The Seekers of Secrets
- SCP-4581 - Anti-Racist Audiocassette
- SCP-4582 - New (New York, New York) York
- SCP-4584 - cold dreams.
- SCP-4585 - Literally a Hamburger
- SCP-4586 - The Well-Mannered Victorian Skeleton
- SCP-4588 - The Sentient Scraps
- SCP-4589 - Unitea
- SCP-4590 - The Manicheans Have the Paintings
- SCP-4591 - Twenty Text Messages
- SCP-4592 - There is Music in the Void
- SCP-4593 - Clevair
- SCP-4594 - There's a gullet beneath London
- SCP-4596 - A Farm Upstate
- SCP-4597 - Thick-Skinned Man
- SCP-4598 - The Spiral Gestalt
4600-4699
- SCP-4600 - Debt
- SCP-4601 - Revenge Of The Redd Mennace!
- SCP-4602 - The Money-ki Neko
- SCP-4603 - The Ballad of Frank and Mia; Written and Composed in B-Major
- SCP-4604 - Disillusionment
- SCP-4605 - E.T. the Earthen Totality
- SCP-4606 - "Deimos"
- SCP-4607 - Whalefall City
- SCP-4608 - Appleseed
- SCP-4612 - Not All Gods Decompose
- SCP-4613 - Edward James Almost
- SCP-4615 - Supper Memories '06
- SCP-4616 - It Haunts The Fields
- SCP-4617 - Selfish Preservation
- SCP-4618 - Anomalous Carpool
- SCP-4619 - reflect.mp4
- SCP-4620 - Bread for Today, Wage for Never
- SCP-4621 - An Eternal Fiery Nightmare
- SCP-4622 - Requiem
- SCP-4623 - The Bard (Owl) of England
- SCP-4624 - Mandatory Fun
- SCP-4625 - Oizys' Hope
- SCP-4626 - The only thing we have to fear...
- SCP-4627 - Familiar, yet different
- SCP-4628 - Pie is Wrong
- SCP-4630 - I Put My Lettuce in the CRISPR and Now It's Sapient
- SCP-4631 - Never a Devil Again
- SCP-4632 - Would you know if you were dreaming right now?
- SCP-4635 - English is the language of the demon.
- SCP-4637 - Resource Allocation
- SCP-4638 - It’s Only Spinach, Really
- SCP-4639 - Product Profile - Citrus Vitae
- SCP-4640 - Let the darn kid experience real life!
- SCP-4641 - Get a Clue
- SCP-4642 - Self-portrait
- SCP-4643 - The Wheel of Fire
- SCP-4644 - Sea, Sky, and Spirit
- SCP-4645 - Blackmailing Computer
- SCP-4646 - Sing Me a Song for the End of the World
- SCP-4648 - Regaining Focus
- SCP-4649 - BLOOD FOR THE BLOOD GOD
- SCP-4650 - A Modern Problem
- SCP-4651 - The Rat Race
- SCP-4652 - Moonbeam Moonshine
- SCP-4653 - Ambrosial Insects and Starving Gods
- SCP-4655 - Comfort Comes In Many Different Forms
- SCP-4656 - Significant Figures
- SCP-4657 - Fireworks For a Friend
- SCP-4658 - Control Kink
- SCP-4659 - Close Encounters of the Sardonic Kind
- SCP-4660 - The Cat Came Back
- SCP-4662 - Billy's Already Home
- SCP-4663 - 3D Printed Spiders Printing Printed Printers Printing Spider Printers Printing Spiders Printing Printed Spider Printers Printing Printing Spider Printers Printing Spiders Printing Printed Printer Spiders Printing Spidered Spider Printers Printing Spider Spider Printered Printer Printers
- SCP-4664 - Nightmare of 20,000 Feet
- SCP-4665 - The Caprine Conspiracy
- SCP-4667 - I Am Become Teeth
- SCP-4668 - Since I Left Me
- SCP-4669 - Nuestra Señora de la Revolución Popular
- SCP-4671 - Clarky the Clown
- SCP-4672 - Meteoric Dog
- SCP-4673 - Reverse Identity Theft
- SCP-4674 - Eternal Beauty
- SCP-4675 - I Don't Exist
- SCP-4676 - The Consequence of Unwanted Isolation or Gratuitous Seclusion
- SCP-4677 - Coke, Cow, and Capitalism
- SCP-4678 - A Time and Place for Regret
- SCP-4679 - The Sweet Taste of Victory
- SCP-4681 - Donec mors nos separaverit
- SCP-4682 - Body Dysmorphia Mirror
- SCP-4863 - Apples of Discord
- SCP-4864 - Wizard Cops
- SCP-4685 - Every Man Must Pay His Due
- SCP-4687 - the call of the void
- SCP-4688 - Manipulative Bike Helmets
- SCP-4690 - Lieutenant Pinkerton Eaten Alive by Fucking Spiders
- SCP-4691 - Locked In
- SCP-4692 - The Curious Case of Jackson W. Parnell
- SCP-4693 - !!WATCH FLIPPIN' FIT FOREIGN CHICKS ENTERTAIN YOU LIVE!!
- SCP-4694 - PryMaid
- SCP-4695 - Synesthesia Inducer
- SCP-4696 - GRONK WANT GUTS! GRONK WANT GUTS
- SCP-4697 - Dropping Off The Kids
- SCP-4698 - Heir To Cernunnos
- SCP-4699 - and only the doorway remains.
4700-4799
- SCP-4700 - Orkney Rising
- SCP-4701 - Well, Yeet Me Mama Like A Wagon Wheel
- SCP-4702 - Gehenna, Unknown to Man
- SCP-4704 - You've Got Maeril
- SCP-4705 - The Hell We Bring With
- SCP-4706 - An Array of Nonsense
- SCP-4707 - R.E.A.D.
- SCP-4708 - Thpecial Containment Prothedure
- SCP-4709 - At The Risk Of Sounding Repetitive
- SCP-4710 - Sheen Gojira
- SCP-4711 - The Inconvenience Store
- SCP-4712 - A Failure of Purpose
- SCP-4713 - "Astromoles"
- SCP-4714 - My Unicorn Friend
- SCP-4715 - A Demon Born of War
- SCP-4716 - The Plutovore's Cookbook
- SCP-4717 - Let It R.I.P
- SCP-4718 - Unsinkable
- SCP-4719 - Cat-train
- SCP-4720 - So Come on ye Childhood Heroes! Won’t You Rise Up From the Pages?
- SCP-4721 - Euclid
- SCP-4722 - Paths to Fulfillment
- SCP-4723 - Reservoir Cats
- SCP-4724 - Making a New Life
- SCP-4728 - Deletion
- SCP-4730 - Reinventive Design for Abnormally Dense Cars
- SCP-4731 - Sublunary Skybox
- SCP-4732 - "Frank Sinatra and Dean Martin: Our Kind of Paradise!"
- SCP-4733 - But Not Forgotten
- SCP-4734 - The K-T Extinction Bootstrap
- SCP-4735 - You're alight again, my dear.
- DEAD WEIGHT ≡ DON'T KILL THE VIBE
- SCP-4737 - Fancy
- SCP-4738 - An Innocent Sin
- SCP-4739 - It's Just Spoiled Milk. I Promise.
- SCP-4740 - As Davy wondered where they'd been, he read a book named Grass and Green.
- SCP-4741 - Rolling Them Bones
- SCP-4742 - A Job Well Done
- SCP-4743 - A Proud Product of Vandelay Industries
- SCP-4744 - Stay Woke
- SCP-4745 - Spooky Scary Snowman
- SCP-4749 - Demoniacal Paper Towel Dispenser
- SCP-4750 - The Little Tailor of Zanzibar
- SCP-4751 - Bed Angel
- SCP-4752 - Mountainous Economics
- SCP-4753 - Mysterious Object at Dodge City
- SCP-4754 - Dentistaurant
- SCP-4756 - A Reborn Man.
- SCP-4757 - Trials of Valhalla
- SCP-4758 - Old Letters
- SCP-4759 - The Challenger of Donut Taxes
- SCP-4760 - An Eye for an Eye
- SCP-4761 - Lost in Yesterday
- SCP-4764 - OKKULT X-PERIENCE OF WYRLDENDING PORPORTIONS
- SCP-4765 - A Shattered Visage Lies
- SCP-4766 - My Beautiful, Beautiful Son
- SCP-4767 - Oh God, I Forgot I Had This Class and the Final Exam is Today
- SCP-4768 - The Tall Tales of Ulysses B. Donkman
- SCP-4769 - Physics Teacher
- SCP-4770 - Crab Cakes
- SCP-4771 - We Don't Deserve Dogs
- SCP-4772 - Kurentovanje
- SCP-4775 - The Absolute Gall
- SCP-4776 - REAGANWEAPON.
- SCP-4777 - Connolly Was There
- SCP-4778 - All's Whale that ends Whale
- SCP-4782 - Nemmie
- SCP-4783 - The Human Capital Convention
- SCP-4784 - Nature Abhors a Vacuum Tube
- SCP-4785 - Infohazardous Cabinet
- SCP-4786 - The Mouth that Hungers
- SCP-4787 - The Things He Wished He'd Known
- SCP-4788 - Cash Cow
- SCP-4789 - Battle for Dreamland
- SCP-4790 - Do not go gentle into that good night.
- SCP-4791 - The Lady's Matchmaker
- SCP-4792 - The Contingency
- SCP-4793 - Stele
- SCP-4794 - The Renegade from Gliese 581
- SCP-4795 - Feathered F(r)iends
- SCP-4796 - Sanctuary of the Sky Pineapples
- SCP-4798 - An Introduction to Transgenic Poetry
- SCP-4799 - Mariachi's Merchants
4800-4899
- SCP-4801 - Ceto-vimutti: Deliverance From Suffering
- SCP-4802 - Dirty Birdy
- SCP-4803 - The Man Documenting
- SCP-4805 - Utilitarian
- SCP-4806 - Appels du Vide
- SCP-4808 - Spontaneous Dog Manifestation
- SCP-4809 - Peeping Doesn't Pay
- SCP-4810 - Hunt Stupid Game, Win Stupid Prizes
- SCP-4811 - Instant Mirror from the Factory
- SCP-4813 - My only way out is to forget I ever need a way out.
- SCP-4815 - Busted Oracle
- SCP-4817 - Horseman Holiday Rentals in scenic King Louis XVI of France
- SCP-4819 - Never Miss the Last Day of Summer
- SCP-4820 - The Custom of the Sea
- SCP-4821 - You Get What I Never Got
- SCP-4822 - Love was Real to Me
- SCP-4824 - The Prince of Sands
- SCP-4825 - Like a lake lake, bake a bake cake.
- SCP-4827 - Ghost Stories Around a Black Hole
- SCP-4828 - The Big Book Of Achievable Spells, made easy
- SCP-4831 - There Are Innocent People on Death Row
- SCP-4833 - The Syncope Symphony
- SCP-4834 - That Picture Perfect Moment
- SCP-4835 - Beef With Beef With Beef With Beef With Beef With Beef With Beef With Beef With Beef With Beef With Beef With Beef With Beef With Beef With Beef With Beef With Beef With Beef With Beef With Beef With Beef With Beef With Beef With Beef With Beef With Beef With Beef With Beef With Beef With Beef
- SCP-4836 - I Love You Beary Much
- SCP-4842 - The Disintegration Loops
- SCP-4843 - Take It With Me When I Go
- SCP-4844 - Last Man Standing
- SCP-4845 - Great Food; No Atmosphere (OR: Tacos That Are Literally Out of This World)
- SCP-4846 - Friendly Fossils
- SCP-4847 - Akanastra
- SCP-4848 - Cross of Iron
- SCP-4849 - Liposlugtion 3: Die Lard With A Vengeance
- SCP-4850 - Madness Leaks Through a Broken Seal
- SCP-4851 - Artificial Selection
- SCP-4852 - Site-19 Goes South For The Winter!
- SCP-4854 - The "Real" Necronomicon and other Godawful Occult Manuscripts
- SCP-4855 - Mind Like a Steel Trap
- SCP-4856 - "Test Case One"
- SCP-4857 - [DESIGNATION AVAILABLE]
- SCP-4858 - But the Rock Cried Out, No Hiding Place
- SCP-4859 - A Game We Play
- SCP-4860 - Clown Building
- SCP-4861 - 12/11/2030
- SCP-4862 - RAGE
- SCP-4863 - Sol n
- SCP-4864 - Depravity and Indifference
- SCP-4865 - Safe safes aren't always safe
- SCP-4866 - 𝘔𝘶𝘳𝘥𝘦𝘳𝘦𝘳™, a product of Optimark Synthetic Personnel Solutions1
- SCP-4867 - Wyoming Territory, 1867-1870
- SCP-4868 - Vendedor Pulpo de Pulpos Vestido En Purpura
- SCP-4869 - Boltz From The Blue
- SCP-4870 - Something's Wrong with Site-17
- SCP-4871 - Mirror Image
- SCP-4872 - Flashback Bug
- SCP-4873 - This Town Ain't Big Enough
- SCP-4874 - Friends With You
- SCP-4875 - Crying Beneath the Desert, Or; Lorem Desertum
- SCP-4877 - Good Airwaves
- SCP-4878 - Six-Foot Soldiers
- SCP-4879 - Art in the Time of Elitism
- SCP-4884 - To Serve Great Man
- SCP-4886 - The Cop and the Countryside
- SCP-4887 - Bloom!
- SCP-4888 - The Sunrise Collective
- SCP-4889 - An Easy Mark
- SCP-4891 - A Great Pestilence
- SCP-4892 - The Rotten God
- SCP-4893 - Agapanthus2
- SCP-4894 - TOOL FOR EVERY USE
- SCP-4895 - George stood alone.
- SCP-4896 - Corvid Knife
- SCP-4897 - Just Pet The Damn Dog
- SCP-4898 - Do You Have What It Takes
- SCP-4899 - Blackbody
4900-4999
- SCP-4900 - A Critique of Man
- SCP-4901 - Remember Rudy Benson.
- SCP-4903 - Eternity, Served Cold
- SCP-4904 - Rapid-Disc-Movement Sleep
- SCP-4905 - Intergalactic TechnoVikings and The Great Moon Wars
- SCP-4906 - On the Sixth Month Gale
- SCP-4907 - Poetry Gnomes
- SCP-4909 - Octopus' Garden
- SCP-4912 - With Great Power
- SCP-4913 - 5-Star [REDACTED]
- SCP-4914 - Gamer Against Weeds
- SCP-4915 - One Star Containment
- SCP-4917 - Law & Oneiroi
- SCP-4918 - Bergentruckung
- SCP-4919 - Belle Époque
- SCP-4920 - Take the Train
- SCP-4921 - Please STOP Reading!
- SCP-4922 - The Rainbow Connection
- SCP-4924 - Tunnel Revenant
- SCP-4926 - Close Call Printing Press
- SCP-4927 - Have a Nice Flight
- SCP-4928 - The Wishing Well
- SCP-4929 - Lake of Rage
- SCP-4930 - Lennon/McCartney
- SCP-4932 - Sadly, Nothing Lasts Forever
- SCP-4933 - We Interrupt This Broadcast
- SCP-4936 - Summer Vacation 🦀
- SCP-4937 - A Deflated Balloon Dog
- SCP-4938 - Sweat of the Sun
- SCP-4939 - The Man on the Moon
- SCP-4940 - Transformer Transformer
- SCP-4942 - How to Summon a Lemon
- SCP-4943 - Transcendence
- SCP-4944 - A Coffee Machine, Except It's Literally Just A Cargo Ship
- SCP-4945 - Hi Hungry, I'm Dad
- SCP-4947 - The Fault and the Fistula
- SCP-4951 - South-Central Protective Services' new Containment Insurance Entity
- SCP-4952 - PlayerUnknown's Robert Frost
- SCP-4953 - Burger King Himself
- SCP-4954 - Long Live the Tinsmith!
- SCP-4956 - Screaming At The Void
- SCP-4957 - Cold, Turning Blue
- SCP-4958 - You Are Loved
- SCP-4959 - Teotihuacan Pterodactylactery
- SCP-4961 - All Dogs Go To Heaven
- SCP-4962 - dack hunt REMIST ER
- SCP-4963 - Static
- SCP-4964 - A Bootleg DVD of The Shaggy Dog
- SCP-4965 - My name is Legion for we are many
- SCP-4966 - Tubbioca: Devourer of Souls, Consumer of Secrets, Lord of Munchies
- SCP-4968 - Deer-mestic Terrorists
- SCP-4969 - Literally Jellyfish Condoms
- SCP-4970 - Universal Tech Support
- SCP-4973 - Dead Men Walking
- SCP-4976 - The Humanity of the Moment
- SCP-4977 - The lucidity of young William Kleiger
- SCP-4978 - BROOK TOWN BEAT DOWN
- SCP-4980 - Alexylva University War Dodo Olympics Team
- SCP-4982 - Heavy lies the crown.
- SCP-4983 - Welcome to Hales
- SCP-4984 - Mycelium memoriae
- SCP-4985 - High Finance
- SCP-4986 - From a Friend
- SCP-4987 - Now Face North
- SCP-4988 - Outsourced Customer Service Contact Center Solutions by Avelar Professional Products, Inc.
- SCP-4989 - The Siege of Site 89
- SCP-4990 - Queen-Sized Bed
- SCP-4992 - Onions Make Me Cry
- SCP-4993 - A Child's Mind Is A Wonderful Thing
- SCP-4994 - An Ideal Foundation
- SCP-4995 - Übermensch
- SCP-4996 - The Demon, The Deal, and The Trashcan Elvis
- SCP-4997 - Cauldros
- SCP-4998 - Space Available, Inquire Within
Фрагмент списка для редактирования
Содержание
5000-5099
5100-5199
5200-5299
5300-5399
5400-5499
5500-5599
5600-5699
5700-5799
5800-5899
5900-5999
5000-5099
- SCP-5004 - MEGALOMANIA
- SCP-5005 - Lamplight
- SCP-5010 - Murder, She Redacted
- SCP-5011 - Man of Steel
- SCP-5014 - Wille zum Leben
- SCP-5015 - (Not) All Who Wander Are Lost
- SCP-5016 - What lies beneath
- SCP-5017 - Hard Landing
- SCP-5018 - The Broken Rose
- SCP-5019 - LoOpy LiLLy
- SCP-5020 - InfeStation™
- SCP-5021 - Long Arm Stretch
- SCP-5023 - Primal Human Needs
- SCP-5024 - The Wandering Library
- SCP-5025 - How I Became a Martyr
- SCP-5026 - Your Story
- SCP-5027 - Schrödinger's Man
- SCP-5028 - Empria's Exile
- SCP-5029 - hello person! Can i help yoo?.png
- SCP-5030 - Junior Researcher Bolívar, deceased during a Containment Breach on 21/12/18
- SCP-5032 - PantherQuest©️
- SCP-5033 - A Pampered Sheep (please don't explode)
- SCP-5035 - The Freedman
- SCP-5036 - Yo Ho, Yo Ho, An Archetype for Thee
- SCP-5037 - Unsolved
- SCP-5038 - La Rue Macabre is CLOSED
- SCP-5039 - Where Did You Go?
- SCP-5041 - The Man in the Iron Mask
- SCP-5042 - The not so funny pages
- SCP-5043 - dado's brainexplsoesenotsrsogsgsdgkpskplsdhpsd, …uh, the… do, the make the your brains have a blow splosion
- SCP-5044 - Insulation Repair: The Blood God Way
- SCP-5045 - You Get Used to It
- SCP-5046 - The Animating Pin
- SCP-5048 - The Bridge of Gaia
- SCP-5049 - Demon Dan's Discount Homunculus Depot
- SCP-5050 - The Dragon of Mittenwald
- SCP-5051 - Severance
- SCP-5052 - The Hand that Mocked Them, and the Heart that Fed
- SCP-5053 - Anything but a stick in the mud
- SCP-5054 - Mr. P
- SCP-5056 - The Constant Companions
- SCP-5058 - Our Normal Fellow Humans
- SCP-5059 - Roll Out!
- SCP-5061 - A Toast To Elizabeth Connors, A Brilliant Actress
- SCP-5063 - Driving The Turtles To Market
- SCP-5064 - Safety Dance
- SCP-5065 - Man of Many Mysteries
- SCP-5067 - A Nuclear Memory
- SCP-5068 - The Microbes Must Be Crazy
- SCP-5069 - The Eightfold Path
- SCP-5070 - Man's (Only) Best Friend
- SCP-5071 - Exquisite Corpses
- SCP-5072 - Some Fireflies in Need
- SCP-5074 - Childhoods End, and Bubbles Burst
- SCP-5075 - All The Hanged Kings, True Care, Truth Brings
- SCP-5076 - Every Planet We Reach Is Dead
- SCP-5077 - Bait and Switch
- SCP-5078 - A Nuclear Family
- SCP-5079 - Isolation Reverie
- SCP-5081 - Snacko™ Brand Delectable Edibles
- SCP-5082 -
Blackline - SCP-5083 - Go For Gold!
- SCP-5084 - Crying Tomatoes
- SCP-5085 - Imprints
- SCP-5086 - The Merits Of A Good Meal
- SCP-5087 - When Have They Gone?
- SCP-5089 - Ode To The Cromwells
- SCP-5090 - Crabnet, The Fastest Internet Server Around!
- SCP-5091 - Sir Skeleton.
- SCP-5092 - The President of The United States Will Scratch Their Nose at 7:53 PM
- SCP-5093 - Damnatio Memoriae
- SCP-5098 - This is a callout post for @x.oPrincessBattyx.o
- SCP-5099 - The Holy Lance
5100-5199
- SCP-5103 - The Spiral's Axis
- SCP-5106 - Goosed
- SCP-5107 - Jesus Christ Super Star
- SCP-5108 - We See You
- SCP-5109 - The One-Time Password
- SCP-5110 - PURE BEAR
- SCP-5111 - Fermi, Exterminated
- SCP-5112 - Roses are read
- SCP-5113 - The Life and Times of Chairman Meow and the Woof Tang Clan
- SCP-5114 - Bureaucratic Warfare
- SCP-5117 - Alex? I’m Lonely
- SCP-5118 - Forever a Good Boy
- SCP-5119 - Uncle Charlie's Toys and Games
- SCP-5120 - Fidelis Roma
- SCP-5121 - Long Distance Relationship
- SCP-5122 -
Eros Bendato - SCP-5123 - Regrets, I've had a few
- SCP-5124 - playdo mous
- SCP-5125 - Matriarch of the Birdmen
- SCP-5126 - Eat Your Mattress
- SCP-5127 - Festive Hat
- SCP-5128 - The Source
- SCP-5129 - The Light, The Heat (In Your Eyes)
- SCP-5130 - A Gluttonous Paradise
- SCP-5132 - The Kids Aren't Alright
- SCP-5133 - Fruit Frogs
- SCP-5134 - Itchy
- SCP-5135 - The War That Never Was
- SCP-5136 - The Matchmaker
- SCP-5137 - Friendship Is Only Skin Deep
- SCP-5138 - Bog Bodies
- SCP-5139 - A Family
- SCP-5141 - Studebaker Special Six
- SCP-5142 - Fruit Salad (っˆڡˆς)
- SCP-5143 - Heavy Fuel
- SCP-5144 - The Mood Ring Mushroom
- SCP-5146 - Perfect Territory
- SCP-5147 - The Mannequin Troupe
- SCP-5148 - Qlippoth
- SCP-5150 - Anomalous Dental Office
- SCP-5151 - Chivalry Never Dies
- SCP-5152 - Memory Mask
- SCP-5154 - Voodoo Child (Slight Return)
- SCP-5156 - monke
- SCP-5157 - Concerning, to say the least
- SCP-5158 - Lacum Lacrimarum
- SCP-5159 - In The Name Of The King
- SCP-5160 - Grandma Sheep believes in you
- SCP-5161 - Hooked
- SCP-5162 - The Weight
- SCP-5164 - Love Crystals (Protect Your Love Life With The Power Of The Foundation)
- SCP-5165 - A Ream of Paper
- SCP-5166 - Inspiration
- SCP-5168 - Go to Sleep
- SCP-5169 - Blow Up Dolls
- SCP-5170 - Pattern Screamer, Esq. 💼⚖️
- SCP-5171 - Galuh's Rhyme
- SCP-5172 - North American Hotel Ice Machines (Zalmunna and Zebah).
- SCP-5173 - Aphelion's Rest
- SCP-5174 - D(ream)DOS Attack
- SCP-5176 - [Little] Caesars' Palace
- SCP-5177 - Lost and Left Behind
- SCP-5178 - Eat The Sun with Seth Uhar
- SCP-5179 - Lostralia
- SCP-5180 - The Federation Awaits, Anomalous Apes
- SCP-5181 - Teufelshunde
- SCP-5182 - But it is us you have forgotten
- SCP-5183 - Under the Surface
- SCP-5184 - SCOTLAND FOREVER
- SCP-5185 - fine spiders by dado
- SCP-5186 - The Depths That Hunger
- SCP-5187 - Standard Procedure
- SCP-5188 - Fronglyfoot Street
- SCP-5189 - Siren Kelp
- SCP-5191 - A Child for Christmas
- SCP-5192 - It's a Trap!
- SCP-5193 - A Lost Marine
- SCP-5194 - Resurfaced Memortics
- SCP-5196 - Fluorescent Adolescent
- SCP-5197 - Department of Frontier Development
- SCP-5198 - For Your Own Good
- SCP-5199 - I Always Loved You, Dear, and I Always Will.
5200-5299
- SCP-5201 - The Manananggal
- SCP-5202 - Clucked
- SCP-5203 - The Child of Mt. Arcadia
- SCP-5204 - Dance On The Shore
- SCP-5205 - Paranormal Activities
- SCP-5206 - Threads
- SCP-5208 - Part of Your Balanced Breakfast
- SCP-5209 - File Upload: Source Unknown
- SCP-5210 - The Goodest Boy
- SCP-5211 - FLAVORDROME
- SCP-5212 - The White Rabbit
- SCP-5213 - The Oracle of the Fae
- SCP-5214 - Lieder für meine toten Töchter
- SCP-5215 - Welp, Sky's Haunted
- SCP-5216 - Even More Good Eats
- SCP-5217 - 3D-extinction
- SCP-5219 - A Completely Random Corpse
- SCP-5220 - The Lady of the Salt Lake
- SCP-5221 - "The Day After Tomorrow"
- SCP-5222 - Lord Explosion's Pyrotechnic Playground and Daycare
- SCP-5223 - Your Own Personal Car Door to Hell
- SCP-5224 - Hecking Frogs
- SCP-5225 - The Abyss Stares Back
- SCP-5226 - Progress Explained
- SCP-5227 - F.O.G /// FEAR OF GOD.
- SCP-5228 - A Pizza That's Also a Computer
- SCP-5229 - Dem Wet Bones
- SCP-5230 - Sweet Dolls Orphanage
- SCP-5232 - Roses in Her Eyes
- SCP-5233 - Mr. Wiggy, Earwig Teacher
- SCP-5234 - Yes, I am looking at you
- SCP-5235 - Thief of Time
- SCP-5236 - Ethics Committee Inquest
- SCP-5237 - In My Head
- SCP-5238 - The Ship of Dreams
- SCP-5239 - Yeah, I wish I'd been, I wish I'd been, a teen, teen necromancer
- SCP-5243 - The Breach that Keeps On Breaching
- SCP-5244 - The Demon God
- SCP-5245 - Iceberg Impersonation
- SCP-5246 - Appeal of Rice
- SCP-5247 - Woeful, Wailing, Whistling Wistful Wind
- SCP-5248 - AJAX ERROR (0)
- SCP-5249 - Kai
- SCP-5250 - Act I: The Lake South, The Deer North
- SCP-5251 - Flax
- SCP-5252 - The Lantern Bearer
- SCP-5253 - Primeval Precambrians
- SCP-5254 - Gotta Catch 'Em All
- SCP-5256 - Perspective
- SCP-5258 - [ACCESS GRANTED] (SCP-5258 (Полигон))
- SCP-5260 - Let Them Dream
- SCP-5261 - Nobody Suspects a Thing
- SCP-5262 - It's Brittany Beach!
- SCP-5263 - The Nail That Sticks Out
- SCP-5264 - Ruining Every Meal
- SCP-5265 - SKYFIRE
- SCP-5266 - IDIOT SUCCUMBS TO NEUROTOXIN WHILE LISTENING TO MACHO MAN CLICK NOW TO SEE
- SCP-5267 - Golems of the Eastern Steppe
- SCP-5268 - Off the Wall Taste
- SCP-5270 - Press X to Bear
- SCP-5271 - there is a god, and they are a penguin
- SCP-5273 - Pasta, lightly seasoned with [COGNITOHAZARD EXPUNGED]
- SCP-5274 - You're Always In My Heart
- SCP-5275 - If You Like It Or Not
- SCP-5276 - Let's Vibe
- SCP-5277 - What Can Go Wrong
- SCP-5278 - A Ghost Town Isn't Always Abandoned
- SCP-5279 - This is Eye-Catching
- SCP-5280 - Honeymandias
- SCP-5281-D - The Man of the Hour
- SCP-5282 - Building Blocks
- SCP-5283 - Please Nerf Nerf
- SCP-5284 - Why the Black Moon Howls
- SCP-5285 - An Economy of Hurt
- SCP-5286 - Autophagia
- SCP-5289 - Miss Flack
- SCP-5290 - Superposition Prism
- SCP-5291 - Transformational Writing
- SCP-5292 - Our Books, Your Library, Together United
- SCP-5293 - Red. Rubber. Ball.
- SCP-5294 - The Emancipatory Society for Middle-Aged Fathers
- SCP-5295 - The Person-to-Personal Computer
- SCP-5296 - An Unbelievable Mistake
- SCP-5297 - JamBomb
- SCP-5299 - Garden
5300-5399
- SCP-5300 - Ship in a Bottle
- SCP-5301 - Angry People
- SCP-5302 - Sweet Bod
- SCP-5303 - No Eyed Girl
- SCP-5304 - 😳SCP REEL😳
- SCP-5305 - All In His Head
- SCP-5306 - The Pirate's Curse, Streaming Now!
- SCP-5307 - Double Donk Juice
- SCP-5308 - A Collection
- SCP-5311 - Who Goes There?
- SCP-5312 - AskSCP.com
- SCP-5313 - town of alma
- SCP-5314 - A fungal chance
- SCP-5315 - Mayan Blue
- SCP-5316 - The Interrogator and the Music Box
- SCP-5318 - Los Ojos de Mi Padre
- SCP-5320 - The People's Church Of The Fish That Just Goes On Forever
- SCP-5322 - And The Road Stretches On...
- SCP-5323 - Reality is Unreelistic
- SCP-5324 - There'll Be No Next Time
- SCP-5325 - The Last Train Home
- SCP-5326 - Make Way for Anderson's Ducklings
- SCP-5327 - Coming of the Seasons
- SCP-5328 - Frozen Nerves
- SCP-5329 - The Truth Hurts
- SCP-5330 - Look Away, Look Away
- SCP-5331 - Night of Fire
- SCP-5332 - Remnants of the Elder
- SCP-5333 - Return the Fish Immediately, Osiris Needs It
- SCP-5335 - The Freudian Split
- SCP-5336 - Custom Print Settings
- SCP-5337 - Barcode Redemption
- SCP-5338 - Sleight of the Bumblebee
- SCP-5340 - The Backyard Memeticist 😎
- SCP-5341 - The Knight
- SCP-5342 - Midsomer Murders
- SCP-5343 - The "For-You News" App!
- SCP-5344 - An Uncertain Volume of Willow Ash
- SCP-5345 - Almost Heaven, West Korea
- SCP-5346 - GUMP
- SCP-5347 - You Are Going To Hy-Brasil
- SCP-5348 - Mama Ambrose's Creamy Mushroom Bisque
- SCP-5349 - The Gutenbug Bible
- SCP-5350 - Oculoma
- SCP-5351 - The Witch of Words
- SCP-5352 - Absence
- SCP-5353 - Does Anyone Remember Fritz Obermeyer?
- SCP-5354 - The View From Caer Bran
- SCP-5355 - YOU THINK YOU'RE BIG, KID?
- SCP-5357 - A History of Rat Control in Alberta
- SCP-5358 -
Vlorschidia - SCP-5359 - The Poem Of The Unknown Lady
- SCP-5360 - 赤いスプラッター殺人事件 (The Red Splatter Murder Case)
- SCP-5361 - The Weather Man
- SCP-5362 - The One with a Thousand Faces
- SCP-5364 - Seventy Millimeter Projector
- SCP-5365 - You Do Not Recognize The Antibodies In D. Walter
- SCP-5367 - The Quantum Curriculum
- SCP-5368 - She Loves Me Not
- SCP-5369 - Had we but World enough, and Time
- SCP-5372 - My Gift to You, Oh Love
- SCP-5373 - Project Neverland
- SCP-5374 - Allen Grey
- SCP-5375 - Nobody and the Name Machine
- SCP-5376 - Turbo Thompson and Deathramp Supreme
- SCP-5377 - OPEN YOUR JUNK MAIL IDIOT, by Y.W.T.G.T.H.F.T.
- SCP-5379 - The Taped Confession
- SCP-5381 - Gashadokuro de azúcar
- SCP-5382 - The Cure, and What Ails You
- SCP-5383 - The Konami Code But For Catholicism (Suffer Overflow)
- SCP-5384 - The Late White Shark
- SCP-5385 - I Watch and Feel You
- SCP-5386 - [PENDING APPROVAL BY ETHICS COMMITTEE]
- SCP-5387 - When Life Gives You Dragonfruits
- SCP-5388 - Fear is Proof of a Degenerate Mind
- SCP-5389 - A Howling in the Deep
- SCP-5390 - Do You Want A Tamale?
- SCP-5391 - Anastasis
- SCP-5392 - The Voyage of the Tachyon Express
- SCP-5393 - To whom it may concern, whales are now considered cavalry.
- SCP-5394 - Bless the Telephone
- SCP-5395 - Thought Bubbles
- SCP-5396 - The best that you could ever be.
- SCP-5397 - "Justice" (2024, melted human flesh on wall, 15 meters by 10 meters)
- SCP-5398 - Regrowing Pains
- SCP-5399 - Seriously, Just One Fly
5400-5499
- SCP-5402 - The Cosmic Courant
- SCP-5403 - A/N: dis is my first post so NO FLAMERZ PLOX!!!1
- SCP-5405 - Bad Design
- SCP-5406 - Duck Dividends
- SCP-5407 - нектар
- SCP-5408 - Customer Dissatisfaction Guaranteed
- SCP-5411 - Alaaniwe
- SCP-5412 - Wasted
- SCP-5413 - Apavitr; Or, I Stared Into A Godless Hole
- SCP-5415 - The 120 Days of Gomorrah
- SCP-5416 - The Lever
- SCP-5418 - Sinners Corpse
- SCP-5419 - A boy and his... dog?
- SCP-5420 - Mission to Meta
- SCP-5421 - Don't. look. up.
- SCP-5422 - Logical Conclusions
- SCP-5423 - The Empty Room
- SCP-5424 - The Stranger
- SCP-5425 - COME UNDONE.
- SCP-5426 - I hate my hate blog
- SCP-5427 - The White Cliffs Of Dover
- SCP-5428 - 101 Household Hints With Eleonor
- SCP-5429 - arm back you
- SCP-5431 - Exploding Head Syndrome
- SCP-5432 - One Apple Pie, Made from Scratch
- SCP-5433 - Casanova
- SCP-5434 - A literal love god failing at love.
- SCP-5435 - If I could burn this town I wouldn't hesitate
- SCP-5436 - Requiem aeternam
- SCP-5437 - A Beast Cast From Heaven
- SCP-5438 - BROKEN BONDS AND SHATTERED TIES
- SCP-5439 - Nose Itch
- SCP-5440 - Hotline Moses
- SCP-5441 - S03 E02 - "The Intern"
- SCP-5442 - A Broken Branch of the Bureau of Alcohol, Tobacco, Firearms and Explosives
- SCP-5443 - Apocalyptic evil? We got some in the back
- SCP-5444 - How To Disappear Completely
- SCP-5445 - Food Guro
- SCP-5446 - Shock Troops
- SCP-5447 - Art Imitates Life
- SCP-5448 - When We Fall Asleep, Where Do We Go?
- SCP-5449 - Choo Choo Spooder
- SCP-5450 - Fintastic Soup
- SCP-5451 - Penguin School, The Best University in the Arctic!
- SCP-5452 - LOVED.exe
- SCP-5453 - A Nice Warm Bowl of Sinigang
- SCP-5455 - Walking Anthills
- SCP-5456 - Sweatmother
- SCP-5457 - The Republic of Under-Frogia
- SCP-5458 - 'Til Death Do Us Part
- SCP-5459 - We're Just Better Than You
- SCP-5461 - In the Mountains of Matrimony
- SCP-5462 - Misery is the State of Every Soul Burdened by Mortality.
- SCP-5463 - New-Fangled Contraption
- SCP-5464 - The Responsibility We Bear
- SCP-5465 - Don't Skip Leg Day
- SCP-5466 - Death of the Creator
- SCP-5467 -
An Uncommon Clairvoyant[PENDING] - SCP-5468 - The Upper Hand
- SCP-5469 - Winnie's Diner
- SCP-5471 - MEMORIAL 6
- SCP-5472 - Smoke & Mirrors
- SCP-5473 - Silence Is Bliss
- SCP-5474 - Reality Check Through The Skull
- SCP-5475 - A Failed Love Story
- SCP-5476 - SCP Explained
- SCP-5477 - Brokeback Labyrinth
- SCP-5478 - Markhaven, Indiana
- SCP-5479 - A Movie of You
- SCP-5481 - The Hugging Trees
- SCP-5482 - I am afraid of being alone in the dark but not of the dark itself
- SCP-5483 - Seafloor Cataloging Procedures
- SCP-5484 - Hellevator
- SCP-5485 - [citation needed]
- SCP-5486 - Conjunction Immemorial
- SCP-5487 - I Want A New Drug (And So Does Miami)
- SCP-5488 - Ratings That Stick
- SCP-5489 - I, Nixon
- SCP-5490 - The Lost Emperor
- SCP-5491 - Disco Never Dies
- SCP-5492 - The Vacuum
- SCP-5493 - So this is how democracy dies... with thunderous ablobs
- SCP-5494 - The Lords of the Beneath World
- SCP-5495 - THE GHAZNI INCIDENT.
- SCP-5496 - The Site-43 Suggestion Box
- SCP-5497 - We Ask You Not to Read This
- SCP-5498 - You've got (my) eyes in the back of your head
5500-5599
- SCP-5500 - Death of the Authors
- SCP-5501 - Empty Portraits
- SCP-5502 - Where the Smoke Trail Ends
- SCP-5503 - Feeling Gut!
- SCP-5504 - A Place to Rest
- SCP-5505 - Hook, Line, And Sinker
- SCP-5506 - The Best Part Of Waking Up Is Manifesting a New God
- SCP-5507 - This Slot is Already Occupied
- SCP-5508 - Pest Control
- SCP-5509 - The Art of War in Contamination
- SCP-5512 - A Social Contract
- SCP-5514 - The Dragonslayer
- SCP-5516 - 101 Lobster Friends
- SCP-5517 - Mother's Grief
- SCP-5518 - Savepoint
- SCP-5519 - A Dark Timeline
- SCP-5520 - The Rabbit Hole
- SCP-5521 - A Long Way From Flavortown
- SCP-5523 - Tomorrow, when the Forests grow, sweetly from your bones
- SCP-5524 - The Insatiable Semantic
- SCP-5525 - The United States Government Loots Atlantis
- SCP-5526 - This file is CLASSIFIED, by order of the Multiversal Foundation Alliance
- SCP-5527 - At The Bottom
- SCP-5528 - all i am is everything im not
- SCP-5529 - Pope Joan II
- SCP-5530 - The Hebridean Charm
- SCP-5531 - Fish! Fish! Fish! Fish! Fish!
- SCP-5532 - The Town That Once Was
- SCP-5533 - You Think, Therefore I Am
- SCP-5534 - Test Anxiety
- SCP-5535 - When Even Your Hand Hates You
- SCP-5536 - From the Prison Moons
- SCP-5537 - For the Seafood Lover in You
- SCP-5539 - Pub Crawl
- SCP-5540 - Last moments of pure recall
- SCP-5541 - Occultation
- SCP-5542 - Cake By The Ocean
- SCP-5543 - Lost Reward
- SCP-5544 - Are You Sick of All the Stares?
- SCP-5545 - 𝙰 𝙱 𝙽 𝙾 𝚁 𝙼 𝙰 𝙻 𝙸 𝚃 𝚈
- SCP-5546 - Send a Letter to Your Representative
- SCP-5547 - Sunken Hope
- SCP-5548 - A Hair Brained Scheme
- SCP-5549 - SECOND SIN.
- SCP-5550 - I, Singh, My Body Collected
- SCP-5551 - Personally, I Prefer Sweet over Savory.
- SCP-5552 - Our Stolen Theory
- SCP-5553 - Psycho Social Media
- SCP-5554 - Aki Aki! 🍊🐻
- SCP-5556 - The Foundation Gets Gnomed
- SCP-5557 - Balloon of Pseudo-Scotus
- 𝒫 - 𝒫 and the Little Party
- SCP-5559-D - The Great Ambrose Bake-Off!
- SCP-5560 - Corvus Series Pocket Prophet
- SCP-5561 - EEE-EEEE
- SCP-5563 - A Free Trial of Knowledge Hoard
- SCP-5564 - Head game
- SCP-5566 - The Scientific Method
- SCP-5567 - Poorly Loved, Poorly Lived
- SCP-5568 - What Friends Are For
- SCP-5569 - Don't Cat Open Inside
- SCP-5570 - Ghosts, Busted
- SCP-5571 - American Backyard
- SCP-5572 - I Ain't No Skeleton's Son
- SCP-5573 - The Eyes of Heaven
- SCP-5574 - Imaginary Suffering
- SCP-5575 - Demolition Retribution
- SCP-5576 - All That’s Left to Regret
- SCP-5577 - The Second Blacksmith
- SCP-5578 - A Terrible Thing To Waste
- SCP-5579 - Boba Roe
- SCP-5580 - Heresiography
- SCP-5581 - To Serve Man
- SCP-5582 - Hard-to-Contain Octopus
- SCP-5583 - Skippy the Unicorn Has Had Enough of Your Shit
- SCP-5584 - Griefing
- SCP-5585 - Immortalized
- SCP-5586 - The Children of Ash
- SCP-5587 - Time is but the Stream
- SCP-5588 - Stars Held Captive Remain Always Gleaming
- SCP-5589 - Battle Toads
- SCP-5590 - That Little Bastard Robot
- SCP-5591 - Easy-Fake Oven
- SCP-5592 - You're Really a Part of Me
- SCP-5593 - Unclogged
- SCP-5594 - Fine Dine and Good Spirits
- SCP-5596 - The Love Doctor
- SCP-5597 - The Cetacean Connection
- SCP-5598 - I, Eurydice Ferlinghetti
- SCP-5599 -
fish golf
5600-5699
- SCP-5601 - Despite All My Rage, I'm Still Just A Bird In A Cage
- SCP-5602 - Why Did The SCP Cross The Road?
- SCP-5603 - A Game Amongst Friends
- SCP-5604 - The Future Will Be Better Tomorrow
- SCP-5605 - Wherever You Go, There You Are
- SCP-5606 - Love in the Time of Flesh-Born Depravity
- SCP-5607 - Urine too Deep
- SCP-5608 - The Delectable Taste of Cognition
- SCP-5611 - A Rabid Dog
- SCP-5612 - Hamartia
- SCP-5613 - Valley of the Flamewars
- SCP-5614 - The Questing Stone
- SCP-5615 -
A SteamyRomanceNovel - SCP-5616 - The Woman in the Incinerator
- SCP-5617 - “Soul”
- SCP-5619 - A Couple of Cuppas
- SCP-5620 - Bear Hunt
- SCP-5621 - Jealousy, Murder, and Alchemy
- SCP-5622 - Your Indoor Neighbor
- SCP-5623 - Star Euthanizer
- SCP-5624 - What Brings Us Together
- SCP-5625 - Team Non-Anom and the Epidemic of Jamais Vu
- SCP-5626 - The Far Shore
- SCP-5627 - The Hungry Caterpillar
- SCP-5628 - OCD? Have you tried unicycle yoga?
- SCP-5629 - Lumbricina Acid Diethylamide
- SCP-5630 - To Let Freedom Wing
- SCP-5631 - To Make the Black Moon Howl for the Motherland
- SCP-5632 - Bomberfish™ By Radiosol And Ambrose Restaurants
- SCP-5633 - This Will Require A Great Amount of Blood
- SCP-5634 - The Agrarian Union of Neche
- SCP-5635 - Hello, this is space speaking
- SCP-5636 - للعدو الموت ("Death to the Enemy")
- SCP-5637 - [Dead End]
- SCP-5638 - Bucket of Karkinos
- SCP-5639 - The Prospero Complex
- SCP-5640 - DUKE ETHEL, WIELDER OF THE UPWATER CIRCLET
- SCP-5641 - Seven Seals, Seven Sages
- SCP-5642 - The Godfryer
- SCP-5643 - Am I Still Me?
- SCP-5644 - The River God
- SCP-5645 - The End of Nothing Special
- SCP-5646 - A Conflict of Interest
- SCP-5647 - Chronos
- SCP-5648 - DOCTOR ROCKEFELLER (ALWAYS WITH TEETH)
- SCP-5649 - What We Missed?
- SCP-5650 - To Cut Salmon by Its Angles
- SCP-5652 - Micro shark
- SCP-5653 - Thirty Pieces of Silver
- SCP-5654 - One More Battle Before the Curtain Call
- SCP-5656 - DEEPWATER DOWNWELL
- SCP-5657 - Nicki Knows
- SCP-5658 - Gravitating in the Moonlight
- SCP-5659 - Deus Sex Machina
- SCP-5660 - POPEHOLE
- SCP-5661 - The Devil and the Maiden
- SCP-5662 - Life and Depth
- SCP-5663 - Sicknasty Truckzilla
- SCP-5666 - When a Mind Flies Into the Sun
- SCP-5667 - The Greenlights
- SCP-5668 - There is an Angel on the Screen
- SCP-5669 - The Sea my Solace
- SCP-5670 - To Pet a Pile of Cars
- SCP-5671 - Before I Wake
- SCP-5672 - Sanctuary
- SCP-5673 - A Forest for Ourselves
- SR #5674 - To See What He Can See
- SCP-5675 - Ce que j'ai fait, ce soir-là
- SCP-5676 - Jesus Loves You More Than You Can Know
- SCP-5677 - Corporate Jungle
- SCP-5678 - The Bamboo Thicket
- SCP-5679 - The Ship's Cat
- SCP-5680 - The Bird Factory
- SCP-5681 - Gehenna Arcade
- SCP-5682 - A Brief Moment of Revelation
- SCP-5684 - Every Single Star
- SCP-5685 - The Airstream Con
- SCP-5686 - Thanks, I'm Cured.
- SCP-5687 - The Interdimensional Bodega! ✨ 📖✨
- SCP-5689 - Him, His Devil, and Confessional
- SCP-5690 - Professional Demonatrix
- SCP-5691 - The Painter of Worlds
- SCP-5692 - Illegal Aliens
- SCP-5693 - If you want to know what God thinks about money, just look at the people he gives it to
- SCP-5694 - The War Pigs, or Pygmalien
- SCP-5696 - One Last Ace.
- SCP-5697 - Don Cavatelli
- SCP-5698 - Economic Migration
5700-5799
- SCP-5702 - 'www.wikiflick.███'
- SCP-5703 - When Lori Came Home For Christmas
- SCP-5704 - Digital Corruption
- SCP-5705 - Powered by Thorium!™
- SCP-5707 - Uncle Sam: The All-American Karcist
- SCP-5708 - From Asgard With Love
- SCP-5710 - The Bach-Werke-Verzeichnis
- SCP-5711 - Threat Level: MIDNIGHT
- SCP-5713 - the holy profit
- SCP-5714 - I Love you to the Cosmos and Back
- SCP-5715 - Ghosts of Time's Past
- SCP-5716 - You Are Not A Robot
- SCP-5717 - Wait for it Wait for it Wait for it
- SCP-5718 - Treasure Island
- SCP-5719 - Atone
- SCP-5722 - Lonely Echoes in Footnotes
- SCP-5723 - Welcome to The Clubhouse
- SCP-5724 - Business-Oriented Chairs
- SCP-5725 - We're Getting the Man Back Together Again
- SCP-5727 - Reggie is OK
- SCP-5728 - The Sarkic Uprising of 1947
- SCP-5729 - The Ghost in the Shed
- SCP-5730 - To Be a King of the Seas Anew
- SCP-5731 - Dolittle's Music Box
- SCP-5732 - And I'm Thinking of What Sarah Said
- SCP-5734 - The Unverb
- SCP-5735 - To Make the Americas Great Again With Turtles
- SCP-5736 - Breakdown, Reform, Lost Along the Way
- SCP-5737 - Entheogen
- SCP-5738 - Opportunity Shackles
- SCP-5739 - ELEPHANT HIDE
- SCP-5740 - all cop are buddy by dado
- SCP-5741 - Marshmellow and Madness
- SCP-5742 - Moloch
- SCP-5743 - Carcinisation
- SCP-5744 - Mealworms
- SCP-5745 - Prehistoric Rift
- SCP-5746 - The Time Stitcher
- SCP-5747 - Three Titans
- SCP-5748 - Meaningless Shapes and Noises
- SCP-5749 - Double Jeopardy
- SCP-5750 - Can't say no to cookies!
- SCP-5751 - The Last Word
- SCP-5752 - Ten Thousand Dreams at Once
- SCP-5753 - duck you
- SCP-5754 - Spare a Hair?
- SCP-5755 - Looking For New Source...
- SCP-5756 - The Constant Reminder
- SCP-5757 - Curse of the Everglade
- SCP-5758 - The Moth Tide
- SCP-5759 - PROJECT VISHAAK
- SCP-5760 - Mr. Atonement
- SCP-5763 - I dreamt I was a butterfly
- SCP-5764 - There is nothing here.
- SCP-5765 - A Room With No Bees in It
- SCP-5766 - Somewhere Comfier
- SCP-5767 - A Wise Old Snail
- SCP-5678 - No One Dies at Disney
- SCP-5769 - All-Seeing Eye Dog
- SCP-5770 - To Parade 'Pendas'
- SCP-5771 - The Mushroom Man
- SCP-5773 - Parasitic Line
- SCP-5774 - Cryptid Catchers: Season 5
- SCP-5775 - Deimos
- SCP-5776 - 100% MOST DEFINITELY A KETER
- SCP-5777 - Irrational Exuberance
- SCP-5778 - Hidden In Plain Sight
- SCP-5779 - Stockholm Syndrome
- SCP-5780 - To Hatch Parises and Chase Geese
- SCP-5781 - Florida Investigators
- SCP-5782 - And Alexander Wept
- SCP-5783 - Accidents Never Happen
- SCP-5784 - This Should Be A -J
- SCP-5785 - Craptivism
- SCP-5786 - We Watch On (Even When We're Gone)
- SCP-5787 - Bad Things Happen in Philadelphia
- SCP-5788 - Partners in sync
- SCP-5791 - Coughing Up Concrete
- SCP-5792 - The New Janitor's Got A Point
- SCP-5793 - Barter, Infinite
- SCP-5794 - Drowning
- SCP-5795 - High Court
- SCP-5796 - The Weather Radar
- SCP-5797 - OVERDRIVE
- SCP-5798 - An Interview with the Drain Snake
- SCP-5799 - The Tooth Striders
5800-5899
- SCP-5801 - Snowman Heaven
- SCP-5802 - Pollution and Industry
- SCP-5803 - One More Song
- SCP-5804 - Regrettable Decisions
- SCP-5806 - Left to Rot
- SCP-5807 - Pelicans Three
- SCP-5808 - Immaculate Misconception
- SCP-5809 - GG EZ GET CARRIED
- SCP-5810 - Of Guilt, Fear, and Hollowness of Heart
- SCP-5811 - How's my summer?(Did It Cure Your Mind?)Thinking why,why(Oh Sweet static{Static{STATIC})
- SCP-5812 - The Punishment Boat
- SCP-5813 - Mr. President II
- SCP-5814 - Substitution Reaction
- SCP-5815 - To Build Heroes as Walls of the Foundation
- SCP-5816 - For King and Country
- SCP-5817 - There's no place like the Republic of Kingston
- SCP-5819 - The Sweet One
- SCP-5820 - exterminate
- SCP-5822 - A Perfectly Normal Set of Garden Gnomes
- SCP-5823 - Conservatives and Coal Mines
- SCP-5824 - The Macguffin
- SCP-5825 - Molly on the Shore
- SCP-5826 - Deadly Deep Diving
- SCP-5827 - 5TAR ☼
- SCP-5828 - As in Life, So in Death
- SCP-5829 - [ACCESS DENIED]
- SCP-5830 - Ahtohallan
- SCP-5831 - The Smeerenburg Daemon
- SCP-5833 - With Their Legs Tied Up in Knots
- SCP-5834 - Tender Sausage of The Ocean
- SCP-5835 - The King In
Yellow - SCP-5836 - To Nobel Peace You Must Prepare For War
- SCP-5837 - The Most Fitting Form
- SCP-5838 - Over the Falls in a Bear-el
- SCP-5839 - There is no present like the future
- SCP-5840 - To Pander with Cola Pandas
- SCP-5844 - Abscess Abyss
- SCP-5845 - With Apologies to Mercury
- SCP-5846 - The One-Stop Shop
- SCP-5847 - The Food's Court
- SCP-5848 - Purgatorius
- SCP-5849 - Dead Letter Arrival
- SCP-5850 - A Train to Hell
- SCP-5852 - "You've got teeth in your bugs."
- SCP-5853 - Ticky Taffy Town
- SCP-5854 - safety park where things do not go wrong
- SCP-5857 - BINARY STAR
- SCP-5858 - The Kindness of Strangers
- SCP-5859 - The PENTAGRAM Papers
- SCP-5860 - To Raise a Hero of the Pen
- SCP-5861 - Foxing
- SCP-5863 - Myths Made Plain
- SCP-5864 - Sir Reginald
- SCP-5685 - Planet D-Class
- SCP-5867 - "Timber? I hardly know 'er!"
- SCP-5868 - Meat
- SCP-5869 - A Glimpse Of Our Future?
- SCP-5870 - To Make Koalas Fly in the Rain
- SCP-5872 - Goodnight, Moon
- SCP-5873 - Britches of Betrayal
- SCP-5874 - The Department of Human Resources
- SCP-5875 - A Call to Adventure in a Missive from Below
- SCP-5876 - Holy Mackeral
- SCP-5877 - Nobodies
- SCP-5878 - The Void Stares Into You
- SCP-5879 - Take Me to the Moor
- SCP-5880 -
Praise Unto the Glorious Influenza, the Great and ContagiousReligious Influenza - SCP-5882 - A 0 Bedroom Apartment
- SCP-5883 - The Flip Side
- SCP-5886 - The Ballad of Jim Biggio
- SCP-5887 - Evacuation
- SCP-5888 - Pariah King (Or:The Greatest Stories Are Those We Carry With Us)
- SCP-5890 - Fall of '84
- SCP-5891 - To Prop Up My Mortal Remains
- SCP-5892 - A Loyal Friend Indeed
- SCP-5893 - Ignitive Stygimolochs
- SCP-5895 - 1000%!! I USED TO GIVE A FUCK
- SCP-5896 - Windows 95 for Elders
- SCP-5898 - Corn Belt
- SCP-5899 - Cowspiracy
5900-5999
- SCP-5900 - PITCHBLACK
- SCP-5901 - World's Greatest Skeeball
- SCP-5902 - The Department of Administration
- SCP-5903 - In Cauda Venenum (What Are You?)
- SCP-5905 - Gashadokuro
- SCP-5906 - How to perfectly kiss vertically
- SCP-5907 - The Perfect Fit
- SCP-5910 - This is a true story.
- SCP-5911 - The SCP Independent Film Festival
- SCP-5912 - To Climb Is To Live
- SCP-5913 - Adventures and Arthropods
- SCP-5914 - A Spider You Cannot See A Second Time
- SCP-5915 - Minds That Wander
- SCP-5916 - Anti-Puncher Shark
- SCP-5918 - Organ Harvesting
- SCP-5920 - Work on What Has Been Spoiled
- SCP-5921 - Greaze Teaze
- SCP-5922 - Duress
- SCP-5924 - Professional Attachment
- SCP-5925 - The Holly King
- SCP-5926 - Fursonal Issues
- SCP-5927 - The Norther' Light Phantom
- FATHER - FATHER and the ties that binds
- SCP-5929 - We Come In Piss
- SCP-5930 - The Bride of Christ
- SCP-5931 - Nobody Shot Me
- SCP-5932-D - MTFinity
- SCP-5933 - And I Won't Forget You, My Love
- SCP-5934 - The Entangled Webs We Cleave
- SCP-5936 - Us Forgotten Few
- SCP-5938 - Seshat's PDF of Programmable Cognitohazards
- SCP-5939 - Stop and read The Roses
- SCP-5940 - ABSOLUTE TOOTH FIELD
- SCP-5941 - Look! A Navel!
- SCP-5942 - The Ethics of Greed
- SCP-5943 - A Solar Conversation
- SCP-5944 - Dead Men Tell No Tales
- SCP-5945 - History is filled with liars.
- SCP-5946 - Lot the Cartographer
- SCP-5947 - SILVERFISH
- SCP-5948 - A Dead Raccοοn in the Middle of the Street
- SCP-5949 - SEVENSEAS
- SCP-5950 - Butt Buddies Forever
- SCP-5951 - Corporate Dealings in the Multiverse at Large
- SCP-5952 - The Warbalang
- SCP-5953 - Critique of the Marine Mammal Program
- SCP-5954 - My Lord, I had forgot the Fart
- SCP-5955 - Fool's Errand
- SCP-5956 - THEREISNOCANNON
- SCP-5957 - A Baleful Light
- SCP-5958 - The Lamb
- SCP-5960 - Webbey's Original Revitalizing Chunky Peanut Butter
- SCP-5961 - Under Pressure
- SCP-5962 - RONALD
- SCP-5963 - Dark Nights at ShowBiz Pizza Place
- SCP-5964 - MC&D's Public Relations Operation
- SCP-5965 - Impact.
- SCP-5966 - The Artist and the Patron
- SCP-5967 - What's your favorite idea?
- SCP-5968 - Starlite Diner
- SCP-5969 - Power Flower
- SCP-5970 - Dustism (Always For You)
- SCP-5971 - A Moment Where Words Don't Reach
- SCP-5972 - Let All the Children Boogie
- SCP-5973 - /Ohio has been eliminated.
- SCP-5974 - The Interactive Fiction
- SCP-5975 - The Cycle Keeps Spinning
- SCP-5976 - Vantage Point of a Nightmare
- SCP-5978 - Toxicity
- SCP-5980 - A king fit for a feast
- SCP-5981 - Nuke City
- SCP-5982 - The Smoke Gets In Your Eyes
- SCP-5985 - Waters of Wisdom
- SCP-5986 - Mom, take me to Millie's Candy Shop!
- SCP-5988 - Deep Sleep
- SCP-5989 - I'm exactly where I need to be.
- SCP-5990 - Out of my head, out of my mind
- SCP-5992 - The Dionysus Pit
- SCP-5993 - We want you to come visit Heaven, just don't fuck with those bees
- SCP-5994 - You Can't Top Pigs with Pigs
- SCP-5995 - The Viper And The Newborn
- SCP-5996 - The Human Amnestic
- SCP-5997 - The River of Mnemosyne
- SCP-5998 - Man, Ascendant
Фрагмент списка для редактирования
Содержание
Корейский филиал
Китайский филиал
Французский филиал
Польский филиал
Испанский филиал
Тайский филиал
Японский филиал
Немецкий филиал
Итальянский филиал
Украинский филиал
Португальский филиал
Чешский филиал
Традиционный Китайский филиал
Вьетнамский филиал
Корейский филиал
- Codename: scka - Defense mechanism
- Codename: L.H. Sein - By people
- SCP-002-KO - Xianess' fountain
- SCP-003-KO - Farmhouse
- SCP-004-KO - Eraser Phenomenon
- SCP-005-KO - Mush-Room
- SCP-006-KO - Killer Bed
- SCP-010-KO - Honest Scam Calls
- SCP-011-KO - The Sleeping Giant
- SCP-014-KO - Ask Anything
- SCP-021-KO - The sage's book
- SCP-022-KO - The magnifying glass
- SCP-033-KO - Print Foundation Documents With Caution
- SCP-034-KO - Wolf Flower
- SCP-048-KO - Science Club
- SCP-049-KO - The Black Parade
- SCP-050-KO - About SCP-050-KO
- SCP-056-KO - [ WARNING: DO NOT READ THIS PAGE! ]
- SCP-064-KO - Seoul Cinematic Production
- SCP-072-KO - Absolute Taste
- SCP-077-KO - The Bermuda Triangle Underwear
- SCP-079-KO - Containment-longing Shuttles
- SCP-086-KO - Knives for Vegans
- SCP-111-KO - A Small Error
- SCP-112-KO - "Dog" Soju
- SCP-113-KO - Eternal Thursday
- SCP-114-KO - LED Fen Fire Flies
- SCP-115-KO - "Meaningless" Regular Polyhedron
- SCP-118-KO - The Savior of All
- SCP-132-KO - Bawling Bamboo
- SCP-137-KO - The Bad Land
- SCP-149-KO - CC BY-NC-ND
- SCP-153-KO - Read me before read below
- SCP-154-KO - Read me before read above
- SCP-157-KO - No time to go to the toilet
- SCP-159-KO - Peach Blossom Land
- SCP-168-KO - Stir-fry?
- SCP-169-KO - The Volition Wins The Day
- SCP-171-KO - Forgotten Music
- SCP-185-KO - Visual Novel
- SCP-188-KO - Heart of the Earth
- SCP-189-KO - Dark alleyway
- SCP-212-KO - Rusty Spade
- SCP-217-KO - USS Enterprise
- SCP-222-KO - A Train in Flames
- SCP-229-KO - Quadrennial
- SCP-234-KO - Doing Dootie Duty
- SCP-268-KO - STRUCTURE ERROR
- SCP-299-KO - A Murder of Crows
- SCP-310-KO - Foods From That Far Place
- SCP-321-KO - Fade-in Virus
- SCP-326-KO - Natural reality fixation
- SCP-345-KO - The Space Hero
- SCP-380-KO - Now the test begins.
- SCP-412-KO - [DATA NOT EXPUNGED]
- SCP-416-KO - There is an instrument buried under the oak tree.
- SCP-432-KO - The Child Gifted With Immortality
- SCP-444-KO - Avici
- SCP-499-KO - The real "BGM"
- SCP-500-KO - The only cure
- SCP-503-KO - Normalcy Classification System
- SCP-505-KO - The Schoolbag
- SCP-521-KO - What is Seeing?
- SCP-545-KO - The Non-Flying Dutchman
- SCP-602-KO - I want to be myself for once
- SCP-621-KO - I will live in ██
- SCP-650-KO - The Duty to Stop All Sin and Unhappiness On This World
- SCP-689-KO - Fangi
- SCP-702-KO - Grownups Don't Know
- SCP-709-KO - Dismembered Eternity
- SCP-713-KO - Gods of the Flying House
- SCP-750-KO - Revenant Soldier
- SCP-755-KO - Learn all the technology and knowledge you want; there are Other Important Things
- SCP-774-KO - Planet Indra
- SCP-797-KO - Skyfall
- SCP-809-KO - Along the thorny vines
- SCP-817-KO - Flame of Love
- SCP-819-KO - Open the Curtains, Lights on
- SCP-824-KO - 22×6×1023 drops of water
- SCP-825-KO - Sokcho Tongkeun Mulhoe Restaurant
- SCP-826-KO - Homo Sapiens
- SCP-827-KO - It's Beginning to Smell a Lot Like Christmas Everywhere I Go
- SCP-828-KO - A Door Locked from the Inside
- SCP-829-KO - MAD man
- SCP-830-KO - 's slippers
- SCP-841-KO - Supervisor: Antimeme Expert Lee Hanseok
- SCP-876-KO - Head Siren
- SCP-877-KO - B████d B████s
- SCP-890-KO - Here be We, the Consequence of Your Actions
- SCP-897-KO - [ASMR] Dentistry / Teeth Extraction Relaxing Sound
- SCP-903-KO - Not Steroids!
- SCP-916-KO - Perfectly Replaces the Biological Patriarch
- SCP-923-KO - The Anti-Disney Department
- SCP-953-KO - Pretending Humanoid
- SCP-973-KO - Man With Gun
- SCP-980-KO - Cloudy with a Chance of People
- SCP-997-KO - The Edge of Esotery
- SCP-516-KO-EX - [DATA REDUCED]
- SCP-7891-KO-EX - Amnestic Mushroom
- SCP-001-EX-KO-J - A Bad Boy
- SCP-1004-KO-J - Girls' Magic Wand
- SCP-none-KO-J - It's an annoying clothes hanger!
Китайский филиал
- CODE NAME: Darkequation - Bamboo Scroll
- CODE NAME: Anglia - Dragon Vein
- CODE NAME: Veleafer - 演绎部
- CODE NAME: Re_spectators - Substitution Reaction
- SCP-CN-009 - Question, Solve, Answer
- SCP-CN-010 - Aye-aye
- SCP-CN-026 - No Longer be Alone
- SCP-CN-048 - A Failed Attempt
- SCP-CN-066 - OMG! What the Foundation Has Failed to Do for 20 Years Was Done by SCP-CN-066 in Just 4 Seconds…
- SCP-CN-096 - "Stop" "Door"
- SCP-CN-111 - The Solitary Venerable One
- SCP-CN-114 - Pine of Awakening Smoke
- SCP-CN-121 - The Badge of Dr. Sun Yat-sen
- SCP-CN-, 00122 - Fifthist Memetics
- SCP-CN-145 - Hometown
- SCP-CN-161 - Interpreter
- SCP-CN-166 - Embryos
- SCP-CN-171 - Dormitory Manager
- SCP-CN-176 - Uncle Sweets
- SCP-CN-180 - SPEEDCORE GENERATOR!!!
- SCP-CN-204 - Thunder Trial
- SCP-CN-233 - Dot Matrix
- 丂匚卩 句丹丂卄 匚几 句丹丂卄 丅山口 几丨几乇 丂丨乂 - 卄丹几乙丨 从乇从乇
- SCP-CN-312 - What Does She Know?
- SCP-CN-326 -
In Fading BooksA Digital Music Fantasy Is Reborn - SCP-CN-366 - Exist
- SCP-CN-369 - Self-Declaration Rostrum
- SCP-CN-404- Memetic Immunity Disease
- SCP-CN-412- Beauty Camera
- SCP-CN-440- Immortals of the Table
- SCP-CN-444 - Heavenly Sounds
- SCP-CN-445 - A Failed Anomalous Document
- SCP-CN-475 - Entombing
- SCP-CN-514 - Insomnia
- SCP-CN-529 - No Longer Human
- SCP-CN-534 - Mr. Dialect
- SCP-CN-546 - Our Secrets
- SCP-CN-661 - Dick, St. Dick
- SCP-CN-666 - Hold the Bottom Line
- SCP-CN-673 - A bunch of statues what move when you dun look at dem
- SCP-CN-675 - The Great Kyet Khaewt Device
- SCP-CN-678 - Stranger
- SCP-CN-713 - Keyboard Fish
- SCP-CN-717 - Throat Forest
- SCP-CN-731 - Black Sunset
- SCP-CN-756 - Book of Numbers
- SCP-CN-757 - Tiny World
- SCP-CN-758 - Mini-Foundation
- SCP-CN-767 - Chart Syndrome
- SCP-CN-797 - The Wandering Train
- SCP-CN-805 - Magic: The Gathering
- SCP-CN-810 - "Gold Foil"
- SCP-CN-829 - Spherical Potatoes
- SCP-CN-844 - The Seed of Lovesickness
- SCP-CN-861 - The pedestrian in a painting
- SCP-CN-879 - Programmable Office Building
- SCP-CN-918 -
Ever-DriftingPaper Plane - SCP-CN-937-J - A Useful Toilet
- SCP-CN-964 - I'll turn on the Bluetooth and listen to some tunes
- SCP-CN-985 - Exam Shark
- SCP-CN-999 - Spreading Your Wings
- SCP-CN-1000 - 2300
- SCP-CN-1001 - Writing Ends Here
- SCP-CN-1050 - "Aquarius"
- SCP-CN-1076 - "Have another bottle"
- SCP-CN-1080 - A Silent Bell
- SCP-CN-1099 -
Tin of Sardines - SCP-CN-1123 - CTTGGGAGATGAATAGATGGGTTGCAACCCATCTATT……
- SCP-CN-1138 - Anime Must Be Destroyed
- SCP-CN-1145 - A Nonexistent Elevator
- SCP-CN-1174 - Royal Quiet Deluxe Typewriter
- SCP-CN-1256 - SCP Foundation Chinese Branch Chronicle
- SCP-CN-1260 - Origin of Species, or Machinery of Creation
- SCP-CN-1276 - "Zekkōchō Conveyor Belt Sushi Restaurant!"
- SCP-CN-1391 - hamster pill by dado
- SCP-CN-1409 - 4200006200
- Work Notes: SCP-CN-1417
- SCP-CN-1424 - not spicy mouthwash by dado
- SCP-CN-1463 - Catgirl Training Plan
- SCP-CN-1483 - Those distant, cold stones
- SCP-CN-1500 - pʰoʃma
- SCP-CN-1537 - Storytelling
- SCP-CN-1604 - A Gun That Gets More Powerful As It Kills More People
- SCP-CN-1621 - become cat pill by dado
- SCP-CN-1666 - Veilbreak
- SCP-CN-1691 - A machine looking for loved ones
- SCP-CN-1733 - The Empty Patches of Sky
- SCP-CN-1767 - What is Papa's Mama Called?
- SCP-CN-1780 - Red Light, Green Light
- SCP-CN-1831 - Human-repelling Incense
- SCP-CN-1835 - The day the music died. Except for you.
- SCP-CN-1837 - USB Sword
- SCP-CN-1920 - J-Q-X, three brothers, see fish eyes and dig them out
- SCP-CN-1976 - Little Red Book
- SCP-CN-1987 - Plunger
- SCP-CN-1997 - When Magic and Science Intersect
- SCP-CN-2019 - Forbidden Borderline Θ
- SCP-CN-2035 - Terminal Entertainment!
- Riddle-2109: God
- SCP-CN-2176 - Zero-Calorie Biscuits
- SCP-CN-2200 - Hyper Dimension Action
- SCP-CN-2215 - A Literary Opinion
- SCP-CN-2227 - Drunk Alone
- SCP-CN-2270 - Rainbow Mount
- SCP-CN-2300 - 1000
- SCP-CN-2304 - The Sun is Tired of Rising
- SCP-CN-2345 - Memory-Carrying Enoki
- Observation File #CN-2380 - When Spring Comes
- SCP-CN-2399 - Still Raining
- SCP-CN-2401 - Sick Hall
- SCP-CN-2402 - The Star Nearby
- SCP-CN-2403 - Dodgeball
- SCP-CN-2405 - Ronald McDonald
- SCP-CN-2406 - ... would much rather have KFC!
- SCP-CN-2426 - McNugget Fundamentalism
- SCP-CN-2440 - A video of torturing tubers
- SCP-CN-2517 - A Man Who Can
not, In Fact, Fly - SCP-CN-2620 - Birthday
- SCP-CN-2626 - D4C
- SCP-CN-2631 - Aliens Speaking English
- SCP-CN-2636 - MTF-己申-20 ("We")
- SCP-CN-2740 -
Addictive Minecraft, Sentient NPCs, Digital Lies, Longing for Reality - SCP-CN-2752 - I See the Machine Core Before the Mechanical Revolution
- SCP-CN-2781 - Before Sleeping
- SCP-CN-2806 - Slickness
- SCP-CN-2835 - Where am I?
- SCP-CN-2878 - Very Annoying Mosquitoes
- SCP-CN-2879 - Very Big Strainer
- SCP-CN-2880 - Very Sharp Sword
- SCP-CN-2918 - The Pleasant Sound of Rain
- SCP-CN-2926 - Big Prime Number
- SCP-CN-2980 - Your Copper Sulfate Friend
- SCP-CN-2987 - Don't Look Up
- SCP-CN-2989 - DEMONSTRATION OF THE PRECENCE
- SCP-CN-2991 - Why disbelieve ye in the revelations of Anormaly, when ye bear witness
- SCP-CN-116-EX - A Dazzling, Lively Relic
- SCP-CN-3300-EX - The Lamb has Died
- SCP-CN-123-J - How Many Urinals Do We Need?
- SCP-CN-213-J - The Magical Geoduck
- SCP-CN-404½-J - "The Foundation is FAKE!"
- SCP-CN-421-J - The Great Radish
- SCP-CN-555-J - Hurts Like Hell!
- SCP-CN-666-J - Mew Mew Mew
- SCP-CN-963-J - Extremely Annoying Codes
- SCP-CN-1616-J - WTF YOU SAID YOU DIDNT REVIEW
- SCP-CN-2000-J - Foundation's Bizarre Black-Technologies
- SCP-CN-2719-J - "Waifu"
Французский филиал
- CODE NAME: Dr. Gray - Not all angels have wings
- CODE NAME: Dr. Johannes - Program Xibalba
- SCP-014-FR - Agent of Chaos
- SCP-021-FR - Lights of the Cliffs
- SCP-027-FR - "Get Rick Rolled"
- SCP-031-FR - The Knowledge-Eaters
- SCP-043-FR - Blind Wanderer
- SCP-045-FR - Thieving Arthropod
- SCP-059-FR - Blizzard's Claws
- SCP-060-FR - The Lich
- SCP-061-FR - The Kiwi
- SCP-073-FR - Biological Sterilizer
- SCP-089-FR - The Athena Project
- SCP-095-FR - The Demon Core
- SCP-113-FR -
Infected fileS.O.S. - Dr. Anton Vehan - SCP-116-FR - Trabant 601 S "Hermes"
- SCP-125-FR - Mark IV
- SCP-137-FR - The One True Religion
- SCP-143-FR - Mesozoic chicken coop
- SCP-150-FR - Vox
- SCP-155-FR - Wake up
- SCP-161-FR - The Book And The Beast
- SCP-164-FR - Creationism
- SCP-172-FR - "Points of View"
- SCP-181-FR - Non-recyclable
- SCP-185-FR - Kinetic Inverter
- SCP-192-FR - Your question
- SCP-197-FR - Gardener Tortoises
- SCP-198-FR - Considerations on the Causes of the Greatness of Mankind and its Decline
- SCP-201-FR - Mind Palace Syndrome
- SCP-213-FR - The Vagabonds of the Dark Forest
- SCP-215-FR - Industrial Sardine
- SCP-218-FR - The Antiquity Manufacturer
- SCP-227-FR - Horoscomaton®
- SCP-233-FR - The Pillow That Makes You Sleep
- SCP-237-FR - Absurd Instability
- SCP-281-FR - The Day The Earth Stopped Being Flat
- SCP-291-FR - Containment Procedures Updated
- SCP-296-FR - Dusk on Mars
- SCP-299-FR - 113-B
- SCP-320-FR - Life is a pillow
- SCP-324-FR - He Died Thrice
- SCP-327-FR - Foresight Cameras
- SCP-335-FR - Lacrymodjinn
- SCP-347-FR - Risky Driving
- SCP-361-FR - Matriarch
- SCP-375-FR - Proof of the existence and uniqueness of the Self
- SCP-400-FR - She's Too Beautiful to be True
- SCP-403-FR - Güiro in Exile
- SCP-418-FR - Maurice the Concept-Eating sheep
- SCP-445-FR - Monkey See, Monkey Shoot
- SCP-466-FR - The Cottage Pottage
- SCP-471-FR - Riders on the Storm
- SCP-476-FR - Molecular Voodoo Dolls
- SCP-484-FR - Billy the Euc-kid
- SCP-503-FR - An Imperfect Allegory
- SCP-505-FR - Before Aleph
- SCP-510-FR - 5 Stars
- SCP-540-FR - The Grass is greener
- SCP-555-FR - The SCP Religion
- SCP-569-FR - Dimensional gloryhole
- SCP-589-FR - The Lamppost Song
- SCP-192-FR-J - Chicken that runs like really really fast
- FCP-676-FR-Vay - Exftremely Danverouf Viruf
- SCP-1054-FR-J - Schisms
- SCP-SKIP-FR-J - Skip For Long Optimal Multifunction Whiteness ©
Польский филиал
- CODE NAME: ZeroStrider — Wingless Birds
- SCP-PL-007 - Happily nonexistent object
- SCP-PL-023 - Written World
- SCP-PL-030 - The Mulch
- SCP-PL-037 - The Haunter
- SCP-PL-052 - Subtemporal bracer
- SCP-PL-057 - Leccinum Disappearing
- SCP-PL-066 - Trapdoor in a storeroom
- SCP-PL-067 - Dog that traveled in time
- SCP-PL-078 - Earrings of Instant Meetup
- SCP-PL-086 - I know about the Foundation
- SCP-PL-091 - Calcumuttons
- SCP-PL-144 - Analogue Virtual Reality
- SCP-PL-149 - The Cinema
- SCP-PL-150 -
On vacations - SCP-PL-152 - Pet snakes
- SCP-PL-160 - Fat Burner
- SCP-PL-166 - Cemetery lights
- SCP-PL-173 - Fungal sounds
- SCP-PL-174 - R'EALITYBLENDER™
- SCP-PL-180 - Those who embark with us
- SCP-PL-183 - Lust of Speed
- SCP-PL-186 - Art is Death
- SCP-PL-195 - Gift from a friend
- SCP-PL-200 - Responsible Reading
- SCP-PL-203 - Weather for 2033
- SCP-PL-204 - How to Disappear Completely and Never Be Found
- SCP-PL-213 - Gloria Necatis
- SCP-PL-231 - The Wrath of Perun
- SCP-PL-248 - Heraclitic Tears
- SCP-PL-253 - WHAT IN THE KENTUCKY FRIED FUCK
- SCP-PL-259 - The list of territories conquered by Genghis Khan is incomplete, you can help by expanding it
- SCP-PL-260 - We know where you live
- SCP-PL-262 - A
- SCP-PL-267 - Mieszko, Mieszko, mój koleżko
- SCP-PL-284 - Oh God, oh fuck
- SCP-PL-289 - A Multidimensional Solution For Shopping at Biedronka
- SCP-PL-290 - Empiricism
- SCP-PL-121-J - Diego the Turtle
- SCP-PL-2004-J - The very fast vehicle of anthropomorphic amphibian
- SCP-PL-2021-J - The hope for our world
- SCP-PL-6470-J - Cat meme [DANGEROUS]
Испанский филиал
- CODE NAME: Uncle Nicolini - The Nexus of Babel
- SCP-ES-038 - The Bussinesman
- SCP-ES-039 - Satellipeople
- SCP-ES-040 -
Polaris Leporidae - SCP-ES-044 - Necrofauna Arthropoda
- SCP-ES-048 - The Power of Ideas
- SCP-ES-054 - The Garden Gnome Gardeners
- SCP-ES-058 - Stilhed Overalt; Silence Everywhere
- SCP-ES-059 - Thirteen Little Fingers
- SCP-ES-069 - The Twine upon the Fate of her Appeal to Look
- SCP-ES-070 - Narcissus and the Plain of the Arrows of Eros
- SCP-ES-076 - https://www.youtube.com/watch?v=fgm14D1jHUw
- SCP-ES-081 - Gluttony
- SCP-ES-083 - deCipher'em All v1.6
- SCP-ES-087 - Sandbox; Intentional Continental Drift; I don't know biology so I'll turn fish into birds.
- SCP-ES-089 - The Last Emperor of Hoiohiña
- SCP-ES-090 -
Nine Lights Emissary - SCP-ES-091 - Eugenics Nightmare
- SCP-ES-095 - A Victimless Crime
- SCP-ES-096 - THE GALLEON, or; Hunt the Dutchman! Or; The Assfuckedship
- SCP-ES-097 - Fungi Reactor
- SCP-ES-098 - Kynodontos
- SCP-ES-099 - The Piano Concert
- SCP-ES-100 - For Your Safety, Please Use the Stairs
- SCP-ES-101 - Ye Shall Not Worship False Gods
- SCP-ES-102 - The Cage
- SCP-ES-103 - Frustrated Musician
- SCP-ES-105 - Stargazing The Other Stars
- SCP-ES-107 - Partnercaller3000
- SCP-ES-111 - An explorer fallen from somewhere else
- SCP-ES-112 - 🤑🔫 pay 2 win 🔫🤑
- SCP-ES-113 - Special Deal
- SCP-ES-115 - This is the Metro of Franco's Spain
- SCP-ES-116 - A Gossiper Gramophone
- SCP-ES-117 - A second chance
- SCP-ES-119 - The Ministry of Abnormalities of Cuba
- SCP-ES-120 - This Sickness Will Not Defeat Me
- SCP-ES-122 - greatGreenishGreenery v1.01
- SCP-ES-123 - Aurus Trading Company
- SCP-ES-125 - North Korean Orbital Bombardment System
- SCP-ES-132 - The Wall; The Selective; The Thing That Kills You; We Don't Let Fools In; The Witch Burning; The Booby Trap; Stress; These Fools Don't Learn; We Have The Key; The Key; I Need Sleep; Sometimes, A Break; Sometimes, A Life; Merlín
- SCP-ES-133 - The Green One always finds its way
- SCP-ES-136 - Penitent Cry
- SCP-ES-137 - Sadness
- SCP-ES-142 - The Bones of the Saints
- SCP-ES-143 - May the Light of St. George lead us to Victory
- SCP-ES-145 - Funerary Licentiousness
- SCP-ES-146 - Who am I?
- SCP-ES-147 - Cessation of Legacy
- SCP-ES-152 - The Fall of the Fools
- SCP-ES-157 - Coppélia
- SCP-ES-158 - And the Potatoes Took Over the Earth
- SCP-ES-163 - Elephant Graveyards
- SCP-ES-165 - Kaiju Sarcophagus
- SCP-ES-169 - The Hentai Dream Made True
- SCP-ES-173 - The last sacrifice to Vulcan
- SCP-ES-178 - The best re-union you will never have.
- SCP-ES-180 - It's not yours, it's ours
- SCP-ES-181 - The King Who Burnt
- SCP-ES-184 - Vitrified Fortresses
- SCP-ES-185 - Space Swallow
- SCP-ES-186 - Absolute Corruption of Power
- SCP-ES-191 -
Stellar Garden - SCP-ES-193 - On the 13th of April, 2013, a Train Fell From the Sky
- SCP-ES-194 - That motherfucker Fidel Castro just won't stay dead!
- SCP-ES-196 - Buried Dreamers
- SCP-ES-199 - Institution for Dealing with Your Issues of Normalcy
- SCP-ES-200 - Mind Control Ball Cactus
- SCP-ES-201 - Theatrum Mundi
- SCP-ES-202 - What is HANSARP?
- SCP-ES-203 - Super Golden Fruit
- SCP-ES-208 - Flying Pigs
- SCP-ES-216 - Lutiya, Pillar of Silence
- SCP-ES-220 - Burning Soul
- SCP-ES-230 - EAGLE Protocol
- SCP-ES-232 - Gramophone Gal (Do You Like Gramophones?)
- SCP-ES-234 - Detective Marw, Private Eye
- SCP-ES-245 - Autarchy of Atonement
- SCP-ES-250 - First Parca: Sons of the Harvest
- SCP-ES-251 - Second Parca: Tales of Misery
- SCP-ES-252 - Third Grim Reaper: The Life of Death
- SCP-ES-256 - At midnight
- SCP-ES-260 - The Blue Eyes of Gea
- SCP-ES-261 - The taste of the stars and the desolation of Juno
- SCP-ES-262 - RAVEYARD
- SCP-ES-264 - A Friendly Crab
- SCP-ES-266 - Scavenger Jellyfish
- SCP-ES-268 - Electromagnet-shrooms
- SCP-ES-284 - A, last? regret
- SCP-ES-288 - Who is that walking beside you?
- SCP-ES-290 - Wrong Taxi
- SCP-ES-296 - The Path From Which We Come From
- SCP-ES-297 - 🌮🔔
- SCP-ES-100-EX - Mother Nature
- SCP-ES-112 Extended Testing Log
- Document-ES-061-B
- SCP-RU-178 - The Heroes Of Vólorovsk
- Proposal by Nico, Who Has Gone A Little Crazy
- SCP-ES-I don't care-J - I don't care
- SCP-ES-050-h2o-J - Bears are better than crocodiles. Probably.
- SCP-ES-101-J - The Hard-To-Open Container
- Emily Miranda Sends Nudes
Тайский филиал
- CODE NAME: DrSSS - Another World Comers
- SCP-009-TH - Human Anatomy Model
- SCP-043-TH - Human Ice Cream
- SCP-072-TH - The Castle Guards
- SCP-400-TH - The Elephant is a Blood-thirsty Animal
- SCP-412-TH - The Lattice (The Hydrologic Cycle)
- SCP-747-TH - The Black Box
- SCP-901-TH - The Giant Head
- SCP-903-TH - Very Huge Dinosaur
- SCP-025-TH-J - Stop for Inspection Sign
- SCP-222-TH-J -
The Troll CatThe Genius Hacker Cat
Японский филиал
- CODE NAME: solvex - Acquittal and Miniascape
- CODE NAME: amamiel - Ave Maria
- CODE NAME: indonootoko - Arahitogami
- CODE NAME: k-cal -
The Balance ScalesThe Handover Report You Want - SCP-010-JP - "Mirai PC"
- SCP-017-JP - Local Rules
- SCP-020-JP - Winged Human
- SCP-023-JP - Shadow Railway Line
- SCP-030-JP - Petroleum Devourers
- SCP-043-JP - Seasoning that Makes Anything Edible
- SCP-047-JP - "For the Greatest Music"
- SCP-065-JP -
from today on i am the prime ministerAll We Need Is Dominator - SCP-076-JP - Terror Overhead
- SCP-082-JP - To the Desired Country
- SCP-086-JP - Zombie Virus
- SCP-088-JP - Babies Can Choose Their Moms and Dads to Be Born to
- SCP-094-JP - Marine Man
- SCP-095-JP - Satō Saitō
- What is SCP-105-JP? I've investigated it in my own way!
- SCP-115-JP - Nue
- SCP-120-JP - The World's Most Valuable Jewel
- SCP-132-JP - One Fish, Two Fish, Paper Fish, Silverfish
- SCP-167-JP - Restaurant Seashore
- SCP-181-JP - Effective Advertising
- SCP-184-JP - Worn-Out Utility Pole
- SCP-194-JP - Paradise Inside a Memory
- SCP-199-JP - Another Audience
- SCP-266-JP - A Town Without Anyone
- SCP-268-JP - The Never-Ending Epic
- SCP-272-JP - "Floora"
- SCP-277-JP - Feigning Death Tank
- SCP-333-JP - The Earthlings
- SCP-359-JP - Penguin Mushroom
- SCP-373-JP - Manufacturing Group
- SCP-398-JP - Eternal Room 105
- SCP-407-JP - A Tub
- SCP-419-JP - An Alternate History of Easter Island
- SCP-444-JP - █████[ACCESS UNAUTHORIZED]
- SCP-475-JP - I Want to See Only Beautiful Things
- SCP-496-JP - Warning: Electronic Protocol in force when viewing this document
- SCP-522-JP - Airborne Baguette Concentration Measurement Station
- SCP-534-JP - Get a Glass for Flea
- SCP-546-JP - Sugar and Spice and All That's Nice
- SCP-548-JP - Singing Rain Sounds
- SCP-557-JP - Déjà Mort
- SCP-558-JP - Bunch o' Chicks 'n' BIG MAMA
- SCP-569-JP - Konpeight
- SCP-571-JP - NIGIRI OF THE DEAD
- SCP-583-JP - Darkness of the Remembrance
- SCP-586-JP - Snow Globes Past the Sell-By Date
- SCP-588-JP - Transdimensional Buttock Wall ~ A Karcist's Ass Sticking Out Into Our Universe ~
- SCP-632-JP - Human Internal Ants
- SCP-646-JP - A Retro-bender
- SCP-654-JP - Matryoshka
- SCP-656-JP - Human Repellant Plastic Bottles
- SCP-671-JP - The Night of Electric Jellyfishes
- SCP-682-JP - Tough Microbe
- SCP-737-JP - Merciful Jewelry Workshop
- SCP-747-JP - How To Boil Some Eggs In This Shifting Universe
- SCP-751-JP - EVERYBODY,FUCK YOU
- SCP-787-JP - How Those Vacuous Spines Got So Close To You
- SCP-818-JP - How great-
- SCP-828-JP - Launching Site
- SCP-830-JP - Downfall of One Night Castle
- SCP-831-JP - Lurking Summer
- SCP-838-JP - Urban Waves
- SCP-903-JP - Mr. Kojirō feat. Joyful Dancers
- SCP-905-JP - Freddie’s Special Flight Show
- SCP-918-JP - That's Someone else's Lost Dreams
- SCP-922-JP - Animal Relocation
- SCP-926-JP - Oneiric Eternal Recurrence Of The Nightmare Beast
- SCP-949-JP - Overrunning Bulldozer
- SCP-981-JP - Wenkankanhoyaukamuy
- SCP-1012-JP - Inversive Monotony
- SCP-1020-JP - Feeding Bowl for Chucky
- SCP-1044-JP - For Those Who Will Listen
- SCP-1045-JP - Corrective Lenses
- SCP-1078-JP - Less Guilt-Provoking Laboratory Organisms
- SCP-1100-JP - CAPTCHA
- SCP-1118-JP - Tokyo DisneySky
- SCP-1134-JP - Explosive Nigiri Sushiblade
- SCP-1139-JP - Electronic Diva
- SCP-1201-JP - Lakebed Electronics Store
- SCP-1242-JP - Abyssal Toilet Stall
- SCP-1249-JP - People
- SCP-1299-JP - They're All Alive
- SCP-1300-JP - An Offering to S
- SCP-1302-JP - Revolving.
- SCP-1304-JP - The Day the Wild Thistle Fell
- SCP-1305-JP - Infinite Monkey Would Never Abuse Drugs
- SCP-1330-JP - Crackti
- SCP-1332-JP - Mule at the Edge of the World
- SCP-1334-JP - Towards the Beach
- SCP-1357-JP - Kingfisher, Shining As Bright As Fire
- SCP-1379-JP - annoying omnipotent
- SCP-1405-JP - British White Silver Garden
- SCP-1407-JP - Chicks could remember
- SCP-1431-JP - I Really Wanna make them into Moss.min.js
- SCP-1440-JP - と
- SCP-1444-JP - Reenacting Proof for the Sake of Pleasure
- SCP-1475-JP - Target North Carolina!
- SCP-1494-JP - The Roadkill is Always Watching Over Us
- SCP-1495-JP - The Bystander is Only Watching for All Time
- SCP-1548-JP - You Offend My Eyes
- SCP-1566-JP - When the Body Dies, the Mind Also Dies; and When the Mind Dies, the Body Is As Good As Dead
- SCP-1576-JP - Hence the God Exists
- SCP-1577-JP - The Cow Lay Down On The Grass Because It Was So Starving
- SCP-1579-JP - A Man's Neighbor
- SCP-1581-JP - Graveyard is Full of Balloons
- SCP-1646-JP - Everything is in a Dream
- SCP-1657-JP - Eyedrops From the 2↑↑↑↑2nd Floor
- SCP-1673-JP - Moses and the Hot Springs
- SCP-1677-JP - Space Jumper
- SCP-1687-JP - With You, Someday/Eternally
- SCP-1690-JP - Tān, or Ouroboros
- SCP-1693-JP - Birth of the Prison
- SCP-1709-JP - Katana of Poetic Justice
- SCP-1710-JP - CHOPIN GODZILLA
- SCP-1721-JP - Love-Doll Retriever
- SCP-1732-JP - Toutei - Invitation
- SCP-1748-JP - Someday Somewhere
- SCP-1774-JP - Natural Apple
- SCP-1783-JP - The Ship is Full of Rabbits
- SCP-1792-JP - Guillotine Lemonade, Friendly Price 25¢
- SCP-1803-JP - Perpetual Generator, or a Black Box
- SCP-1810-JP - QR Bird
- SCP-1828-JP - Foggy Forest
- SCP-1841-JP - Don't Get Off Your Pedestal
- SCP-1857-JP - Cherry Blossom of Permanence
- SCP-1866-JP - A Job to Save the World
- SCP-1868-JP - Freed Headless Feline Carcasses (they can't go anywhere in the first place, and the neighbors don't give them a shit)
- SCP-1873-JP - Yoke of Flesh
- SCP-1876-JP - Out of Mom
- SCP-1934-JP - Shiba Inu on the Suspension Bridge
- SCP-1936-JP - This Connection Has Been Severed by a Nightmare Collective
- SCP-1944-JP - Unfortunate Flying Object
- SCP-1977-JP - Death Got A Non-Aquaphobic Horse
- SCP-1978-JP - Sailor Suit and Machine Gun
- SCP-1988-JP - Heisei Convenience Store Myths
- SCP-1995-JP - Ushi-Gozen
- SCP-1998-JP - A Girl Who Changes Shape with Extreme Force and a Super Deranged YouTuber
- SCP-2005-JP - Sword of Judgement, Bell of Forgiveness
- SCP-2048-JP - An Ordinary Coin
- SCP-2057-JP - Back to the Egg, Then It Hatches
- SCP-2061-JP - Adventure Tale at Gyouseiya Department Store
- SCP-2077-JP - Turing Shredder
- SCP-2113-JP - And He Closed His Eyes
- SCP-2152-JP - Tranquility, Anxiety, Drinking Down into the Darkness
- SCP-2170-JP - Oneigal Upload
- SCP-2188-JP - Light Fingers with a Ready Tongue
- SCP-2200-JP - BBC
- SCP-2203-JP - Reset
- SCP-2211-JP - Foundation Department of Hell
- SCP-2227-JP - Tell Me Stories
- SCP-2233-JP - He Who Was Mourned By As Many People As Possible
- SCP-2300-JP - Whether I Stay or Not, I May Never Go Anywhere
- SCP-2351-JP - Virtue's Vengeance
- SCP-2371-JP - Soytaurus
- SCP-2403-JP - Invasive Species Throwing Dude
- SCP-2422-JP - Language Kusōzu
- SCP-2424-JP - Lincoln Century
- SCP-2426-JP - Won't You Jump Out At Me From That Corner?
- SCP-2429-JP - Pufferfish Eten
- SCP-2433-JP - Wrongful Indulgence
- SLOT UNALLOCATED - That Which Kills Me
- SCP-2459-JP - It Must Be a Warm Place That Leads to Hell
- SCP-2472-JP - Nyankoderoga
- SCP-2476-JP - cat.exe (Modification Prohibited)
- SCP-2493-JP - Broken Smile
- SCP-2503-JP - Those Who Wait for Absolute Zero
- SCP-2505-JP - Processed Quail
- SCP-2507-JP - Jumpscaring Ghosts
- SCP-2513-JP - At Least, Be the Foundation
- SCP-2566-JP - RETURN PARADOX
- SCP-2580-JP - The Great Death
- SCP-2581-JP - Make Me Look Pretty☆
- SCP-2601-JP - "Me, and Yayoi, and Miyuki, and..."
- SCP-2613-JP - Fear Conditioner
- SCP-2626-JP (SCP-262-IE) - Casadh an tSúgáinTangled Thread
- SCP-2642-JP - Making "Project Arca"
- SCP-2650-JP - Transfeuneral
- SCP-2687-JP - Meaning of Life/Meaning of Death
- SCP-2707-JP - Floral Tribute for Me
- SCP-2733-JP - The Road To Hell Is Paved All Over With Good Intentions, Even Having Information Signs
- SCP-2744-JP - てるてるネコちゃん
- SCP-2755-JP - A Star at the Bottom of a Lake
- SCP-2760-JP - Dazzling with gold
- SCP-2784-JP - Someone is Talking About You Somewhere
- SCP-2788-JP - Your nth Dead Grandma
- SCP-2790-JP - Foundation Department of Retention
- SCP-2833-JP - SKYWELLS: THE SECOND
- SCP-2840-JP - The Room
- SCP-2844-JP - Cognitive Dissonance
- SCP-2851-JP - No Longer Red Needed
- SCP-2855-JP - SKYWELLS: THE FIRST
- SCP-2856-JP - My Hero
- SCP-2880-JP (Unassigned Number)
- SCP-2891-JP - Interstellar Retribution
- SCP-2904-JP - How Many Pigs Have You Ever Murdered?
- SCP-2920-JP - Strangulation Demon
- SCP-2955-JP - Septette for the Dead CN-Aniki
- SCP-2973-JP - The Man with the Most Powerful Abilities Ever
- SCP-2975-JP - "Cuz When I'm Up Late, I Wanna Eat Somethin'"
- SCP-2989-JP - The Star of My Wish Rises in the Clear Blue Sky
- SCP-666-JP-J - The Ultimate Horrible Object
- SCP-999-JP-J - The Tickle Master
- SCP-Shrimp-JP-J - > A saury <
- SCP-K2-JP-J - Oh shit !!!
- 5Ç卩-譁?ュ怜喧縺-JP-J - Untellable
- SCP-014-JP-EX - I Just Wanted to See that Look on your Face
Немецкий филиал
- SCP-009-DE - Cheap Gas
- SCP-015-DE - Dr. Duck
- SCP-017-DE - R.T.I. Grizzly A1
- SCP-028-DE - Sonderkommando for the paranormal
- SCP-030-DE - R.T.I. Hammer P1
- SCP-031-DE - Isabelle
- SCP-034-DE - Shower of dread
- SCP-042-DE - Avoid Containment
- SCP-045-DE - What are you searching for?
- SCP-046-DE - Shuffling Corpse
- SCP-051-DE - Mr. Soother
- SCP-056-DE - R.T.I Sentinel
- SCP-058-DE - Peaceful Zombies
- SCP-066-DE - The little Spellbook
- SCP-070-DE - Pink Colony
- SCP-076-DE - Face-Swap App
- SCP-083-DE - Badge of Physical Fitness
- SCP-087-DE - Confused AI
- SCP-089-DE - The Athena Project
- SCP-090-DE - I‘m SCP!
- SCP-091-DE - The Loving Doll
- SCP-096-DE - A Cosmic Phenomenon
- SCP-098-DE - Demon vs Machine
- SCP-099-DE - Gasmen
- SCP-100-DE - The gargoyle's misdeeds
- SCP-101-DE - Eik, the Tree of Knowledge
- SCP-117-DE - The News of the Day to Come
- SCP-121-DE - Telepathic humanoid
- SCP-122-DE - Frau Harlekina
- SCP-124-DE - Don't notice me
- SCP-125-DE - The Imprisoned Regent
- SCP-131-DE - Real Estate Shark
- SCP-136-DE - The boy who stops time.
- SCP-137-DE - Ice Phoenix
- SCP-140-DE - Morts volantes
- SCP-148-DE - Blue Slime [Level 25]
- SCP-149-DE - The Spirit of Ruin
- SCP-150-DE - Die Verteidiger
- SCP-173-DE - Hating Stones
- SCP-177-DE - The Rungholt Shard
- SCP-178-DE - Dreamlike Weather
- SCP-179-DE - To the most Righteous
- SCP-180-DE - A little cute Birthdaypenguin
- SCP-184-DE - Arachnophilia
- SCP-186-DE - The True Meaning of Christmas
- SCP-187-DE - Mathilda
- SCP-188-DE - B4 “Blitzgewitter”
- SCP-190-DE - Thor, God of Kebab
- SCP-192-DE - "Knowledge"
- SCP-200-DE - Higher Mathematics
- SCP-201-DE - Metal Dragon
- SCP-204-DE - The Chest of Eternity
- SCP-207-DE - The heart of Cupido
- SCP-208-DE - St Caesarius Hospital
- SCP-209-DE - The idiot box
- SCP-226-DE - Knight Cuddle Steel
- SCP-227-DE - Moo
- SCP-234-DE - A Christmas miracle
- SCP-236-DE - A cup of love
- SCP-237-DE - Her heart and his soul
- SCP-239-DE - USB Jird
- SCP-248-DE - Omni fork
- SCP-255-DE - The Perfect Mascot
- SCP-257-DE - A butt ugly owl
- SCP-260-DE - Ahead of her time
- SCP-272-DE - Megalodon
- SCP-281-DE - A pretty good hotel
- SCP-292-DE - Sweet Easter
- SCP-293-DE - Aliens, go home!
- SCP-296-DE - In death we blossom
- SCP-297-DE - Combustible Deep-Sleep
- SCP-299-DE - What the Future Holds
- SCP-004-DE-EX - Repulsive
- SCP-015-DE-J - This is why the SCP Foundation hates Ducks and Geese
- SCP-027-DE-J - The Big Bad Tap Hen
- SCP-033-DE-J - Earworm
- SCP-044-DE-J - This damn schnapps
- SCP-(INSERTANYNUMBERHERE)-DE-J - The Trainee
- The Things Dr Ore Is Not Allowed To Do At The German Branch Of The Foundation
Итальянский филиал
- CODENAME: /GRAF - The Dragon Of Revelation
- CODENAME: /ABAD - The Values Of The Fatherland
- SCP-002-IT - The Voice of the Piave
- SCP-010-IT - Parental Care
- SCP-011-IT - The Zero Zone
- SCP-012-IT - Waltz No. 2
- SCP-013-IT - Sentient Tornado
- SCP-015-IT - The Boogeyman
- SCP-017-IT - Sentient USB Pendrive
- SCP-018-IT - EMP Barn Owl
- SCP-019-IT - E-15 Chimera
- SCP-020-IT - Horse with Oratory Skills
- SCP-021-IT - The Capitoline Wolf
- SCP-022-IT - Legion
- SCP-023-IT - Hounds of the Dictator
- SCP-024-IT - Rebar ಉ
- SCP-025-IT - Kangaroo Mother
- SCP-029-IT - The Last Vestal
- SCP-032-IT - Haruspex
- SCP-035-IT - The Hammer
- SCP-037-IT - Subtle Vibration
- SCP-038-IT - Ocean Stones
- SCP-039-IT - Cordless Telephone
- SCP-041-IT - A Flat World
- SCP-042-IT - The Answer
- SCP-045-IT - The Hypogea of the Daunia
- SCP-050-IT - The Galleass
- SCP-054-IT - Microcosmos
- SCP-055-IT - The Devourers
- SCP-057-IT - Under the Sea
- SCP-066-IT - Diabolus ex Machina
- SCP-067-IT - The King of the Hill
- SCP-068-IT - Kaliperia
- SCP-070-IT - Forgotten Depths
- SCP-071-IT - Ötzi's cloak
- SCP-079-IT - Locus Amoenus
- SCP-080-IT - Shattered Civilization
- SCP-082-IT - The Helmet of Knowledge
- SCP-100-IT - Carnem Levare
- SCP-103-IT - Ciapapuer
- SCP-105-IT - Anachronistic Hallucinogenic Excrements
- SCP-149-IT - After the End of the Eternity
- SCP-004-IT-ARC - Infinite Tuning Guitar
- SCP-008-IT-ARC - The Hotel
- SCP-014-IT-ARC - XXXIII (Before Rewrite)
- SCP-001-IT-J - The “Dragon” Of Revelation
- SCP-002-IT-J - The Doctor-Destroyer
- SCP-610-IT-J - The Perfect Projectile
- SCP-1900-IT-J - The Pirate Kingdom
- SCP-F2Y-IT-J - The [EXPLICIT]
- Italian Sites -J - The best Sites of the Italian Branch!
Украинский филиал
- SCP-012-UA - The Library
- SCP-035-UA - Tablet of Veles
- SCP-038-UA - Alike to black holes
- SCP-046-UA - Tasty flashbacks
- SCP-049-UA - Apparently... God?..
- SCP-054-UA - Pater noster Bandera
- SCP-056-UA - Pit on the road
- SCP-065-UA - Deliver Us From Evil
- SCP-069-UA - Cast-iron charcoal iron
- SCP-079-UA - No-Sides
- SCP-081-UA - Vanka-Vstanka
- SCP-095-UA - Crazy Bee
- SCP-2014-UA-EX - SCP-2014-RU
- SCP-692-UA-J - Connection cockup
Португальский филиал
- CODINAME: Project Bulwark - by slashannemoo & Vintner
- SCP-002-PT - Women's Magazine
- SCP-003-PT - Silent Droplets
- SCP-004-PT - The Soldier and the Bomb
- SCP-006-PT - Freefalling Nightmare
- SCP-008-PT - Man-Man
- SCP-010-PT - Peppers
- SCP-011-PT - Victoria stella
- SCP-013-PT - Crazy Cyborg's Samba
- SCP-014-PT - Improvised Appearances
- SCP-015-PT - Electromagnetic Cannon
- SCP-016-PT - The Holy Grail
- SCP-018-PT - Unrecorded Man
- SCP-019-PT - Porcelain Dish
- SCP-021-PT - Crystal Theatre
- SCP-022-PT - Lawyers = Fairies and Vice Versa
- SCP-023-PT - Xeno's Paradox
- SCP-024-PT - A Longtime Friend
- SCP-025-PT - Portable Desert
- SCP-026-PT - Sober Drunk
- —————— - This Shouldn't Exist
- SCP-030-PT - Cultural Heritage
- SCP-031-PT - Pocket Imp
- SCP-034-PT - Creator Magnifying Glass
- SCP-035-PT - The Pigeon
- SCP-038-PT - Floating Snake
- SCP-040-PT - Ostium Theater
- SCP-041-PT - A Weapon Among the Stars
- SCP-042-PT - The ████ Opener
- SCP-043-PT - The Player
- SCP-046-PT - Read a Book, Write a Book
- SCP-049-PT - <N0:.WH3RE>
- SCP-050-PT - The Sack Man
- SCP-055-PT - Adaptive Tactical Armour for Containment and Assault
- SCP-057-PT - The Abandoned Hospital
- SCP-065-PT - Hard-to-Kill Armadillo
- SCP-078-PT - The Fog
- SCP-079-PT - Schrödinger's Planet
- SCP-088-PT - This Machine Kills Commies
- SCP-089-PT - I Shall Deeply Love You
- SCP-094-PT - Apamachi Identity Camouflage Device.
- SCP-101-PT - Manor of Madness
- SCP-106-PT - Sonic Flashlight
- SCP-110-PT - A Very Convincing Story
- SCP-118-PT - That Which Shares
- SCP-119-PT - The Pompous Girl
- SCP-122-PT - Factor XX
- SCP-143-PT - Escape from the Rio-Niterói Bridge
- SCP-150-PT - P███ G████´s Progressive Location Pen
- SCP-166-PT - The Light of the Court
- SCP-170-PT - [31/12/2025]: thank you.
- SCP-172-PT - Mother-of-Gold
- SCP-177-PT - Time Travelling Lottery
- SCP-191-PT - Acre's UFO
- SCP-195-PT - Special Gift for Naughty Workers
- SCP-196-PT - Midas Gloves
- SCP-199-PT - Spread the Word
- SCP-033-PT-EX - Dream-Catcher
- SCP-019-PT-J - The Big Ban Hammer
- SCP-045-PT-J - Monsterwave
- SCP-075-PT-J - Good Morning!
- SCP-109-PT-J - The Foundation
- SCP-005-PT-ARC - The Reason Why Dendrophobia Exists
- SCP-012-PT-ARC - Socrates
Чешский филиал
- SCP-017-CS - Absolute Justice
- SCP-023-CS - Why can't he just leave me alone?
- SCP-042-CS - Northern Devil
- SCP-073-CS - The cousin of Winnie the Pooh
- SCP-082-CS - Captive of a frequency
- SCP-087-CS - Splendid Light
- SCP-148-CS - Unfinished Business
Традиционный Китайский филиал
- SCP-ZH-002 - Taiwanese Unicorn
- SCP-ZH-003 - Extreme Religion
- SCP-ZH-004 - Marslow’s Daughter
- SCP-ZH-005 - If you haven't re-shared this article with ten friends, then…
- SCP-ZH-006 - The real meaning of popcorn
- SCP-ZH-037 - Tears from Hawksbill Sea Turtle
- SCP-ZH-038 - The Faceless Model
- SCP-ZH-041 - Dreams
- SCP-ZH-048 - Sword & Sorcery and Tea & Magic Hands
- SCP-ZH-060 - The Deer Road Tunnel
- SCP-ZH-105 - The Unfilials
- SCP-ZH-132 - The 007 Game That Kills You
- SCP-ZH-178 - The Bird Mug
- SCP-ZH-200 - Let's Tag
- SCP-ZH-228 - Tsuipu, 1947
- SCP-ZH-236 - Last Year Syndrome (Senioritis)
- SCP-ZH-251 - Ruins In Third Floor
- SCP-ZH-261 - Cuban Sugar
- SCP-ZH-282 - The Gourmet
- SCP-ZH-310 - Anomalous Protein Domain
- SCP-ZH-446 - Became Bug
- SCP-ZH-526 - I’m Just a Toaster
- SCP-ZH-545 - I'm Not A Dinosaur
- SCP-ZH-617 - The Brave One From the West
- SCP-ZH-618 - Sun Pastry Lion
- SCP-ZH-736 - You Can't Go Any Further
- Mrs. Alicia
- SCP-ZH-860 - dado's Hair/Have-fortune Drug
- SCP-ZH-889 - Beyond This World
- SCP-ZH-973 - As Your Hatred
- SCP-ZH-2005-EX - Internet Celebrity
- SCP-ZH-9288-EX - You are completely aware that you will never meet the person sitting next to you listening to your story ever again.
- SCP-ZH-00l - SCP-ZH-001
- SCP-ZH-60053-J - HONK
Вьетнамский филиал
- SCP-002-VN - Funeral
- SCP-006-VN - The Night Stars
- SCP-012-VN - One Gains, What One Wishes
- SCP-013-VN - Poisonous Milk
- SCP-014-VN - Dream Crayons™
- SCP-018-VN - The Two-Wheeled Hatred
- SCP-024-VN - The Beginning of All
- SCP-033-VN - Rubber Duck
- SCP-036-VN - The Cube
- SCP-040-VN - Those Black Words
- SCP-096-VN - Where the Earth Meets the Tide
- SCP-099-VN - The Waifu Heaven
- SCP-100-VN-J - The True Omnipotent SCP
- SCP-6789-VN-J - A Kettle-Class Loudspeaker
Фрагмент списка для редактирования
- CODENAME: Cimmerian/kaktus Proposal - "The Broke God"
- CODENAME: Henzoid-Crocket's Proposal - "When Day Breaks Up"
- CODENAME: Fishish's Proposal - "Truth Hurts </3"
- CODENAME: Plauge's Proposal - The Great Seal
- SCP-002-J - Amnesiac Treatment
- SCP-004-J - Stan from Accounting
- SCP-6k-J - Out of the Mouths of Babes
- SCP-7K-J - Upvote/Downvote Coin
- SCP-8==D-J - Monster Containment for My Monumental Dong
- SCP-015-J - Just Really Misunderstood
- SCP-017-J - Narcissistic Time Displacement Field
- SCP-018-J - Normal Trench Coat Worn By An Adult
- SCP-027-J - Schrödinger's Remote
- SCP-027-DE-J - The big bad tap hen
- SCP-029-J - Jesus Take the Wheel!
- SCP-031-J - Evening of Terrors
- SCP-042-J - Billions of Anomalous Pillows
- SCP-044-J - SCP-J(argon)
- SCP-044-DE-J - This damn schnapps
- SCP-063-J - Non-Euclidean Geometries
- SCP-80s-J - Strangerer Things
- SCP-80-K-J - Chicken Corps
- SCP-093-J - Failed Embezzlement Scheme
- SCP-096-J - NarrAway
- SCP-ES-101-J - The Hard-To-Open Container
- SCP-103-J - Confirmed
- SCP-106-J - The Barbecue Man
- SCP-0110-J - Personal Retirement, Effective Immediately
- SCP-118-J - The Saltiest Doctor Alive
- SPC-126-J - Not Shark For Work
- SCP-143-J - insert witty name here
- SCP-164-J - Ear Magic
- SCP-184-J - The Elaboration Squirrel
- SCP-222-J - Contagious Biophysical Behavior
- SCP-248-J - Picture It
- SCP-273-J - ‘Freezies’
- SCP-294-J - Genesis, Freshly Brewed
- SCP-300-J - Our Glorious Ruler
- SCP-314-J - Numerical Proofs (That You Suck)
- SCP-334-J - The Lost Sock Room
- SCP-419-J - A Trustworthy Man
- SCP-444-J - Six Day Long Fruit Preserves Convention
- SCP-477-J - This Should Be A Mainlist
- SCP-543-J - Tweetle Beetles
- SCP-555-J - Squid Mop
- SCP-615-J - Diplomatic Immunity
- SCP-630-J - A Song In Their Heart
- SCP-661-J - Crippling Indecisiveness
- SCP-721-J - A Stupid Dog Picture
- SCP-732-J - Tiny Ceramic Seahorse
- SCP-733-J - System Of A Down
- SCP-800-J - American Football
- SCP-810-J - A Dog In Need Of Funds
- SCP-900-J - Modern Major Keter-Class
- SCP-930-J - You little rascal!
- SCP-939-J - Crime Time Canine
- SCP-990-J - Dream Dude
- SCP-1020-J - Fridge Horror
- SCP-1040-J - A Dangerous Mental Contagion
- SCP-1049-J - The Grim Bucket
- SPC-1057-J - Absence Of Punchable Shark
- SCP-1089-J - The Carpet Ate It Again
- SCP-1111-J - A Working Computer
- SCP-1131-J - It works, guys! Trust me!
- SCP-1132-J - Head-Cannons
- SCP-1134-J - Masking Tape
- SCP-1162-J - "Double Down Sandwich"
- SCP-1224-J - Duck-Class Personnel
- SCP-1256-J - Bees are Dumb as Fuck, Much More So than You Could Possibly Imagine
- SCP-1294-J - Watering-down Can
- SCP-12954-J - Damn, That's Deep
- SCP-1417-J - Passive-Aggressive Meteorite
- SCP-1472-J - Scranton Realty Anchors
- SCP-1557-J - The Writer's Block
- SCP-1595-J - Sweethearts
- SCP-1622-J - No Object Class Whatsoever
- SCP-1638-J - A Dark and Mysterious Printing Plate
- SCP-1797-J - "GEORGE WASHINGTON ENTERTAINING A GENTLEMAN FRIEND WHILE PICKING HIS NOSE"
- SCP-1830-J - Opening Line
- SCP-1840-J - The Hard Sell
- SCP-1851-J - Fibber Lake
- SCP-1914-J - Silencing Piano
- SCP-1921-J - Riemann's Router
- SCP-1939-J - FIX MY FUCKING ROOF
- SCP-1948-J - The Comrade
- SCP-1950-J - Locked away in the tallest Containment Cell
- SCP-1955-J - Musical Audio Surveillance Distortion
- SCP-1981-J - Just A Small Town Girl
- SCP-1997-J - Pro-Pain
- SCP-2001-J - Laser Butt Disease
- SCP-2002-J - The -J stands for Jaywalker
- SCP-2019-J - a shaggy dog
- DDD-2034 - Destroy, Destroy, Destroy
- SCP-2100-J - Hard-Boiled Fedora
- SCP-2130-J - "But seriously, folks..."
- SCP-2421-J - The Upvote Syndrome
- SCP-2600-J - Bicycle Mafia
- SCP-2618-J - Then Who Was Nanners?
- SCP-2718-J - Weekend at Dammerung's
- SCP-2719-J - an inside joke
- SCP-2772-J - SUV Sales Pitch
- SPC-2935-J - O, Fin
- SCP-2950-J - THE POSTCARD
- SCP-3001-J - Brown Reality.
- SPC-3008 - A Perfectly Normal, Regular Old BLÅHAJ
- SCP-3034-J - Voresnake
- SPC-3284-J - Lava Sharks
- SCP-3333-J - Angsty Teenage Plant
- SCP-3448-J - Should Have Taken Him Sleeping
- SCP-3472-J - In time, you will come to hate me.
- SCP-3560-J - A Discerning Gentleman
- SCP-3790-J - Pantopicon IV: The Search for Pantopticon III (sic)
- SCP-4000-J - 2boo
- SCP-4001-J - Life, Read Right to Left
- SCP-4237-J - Object of Indescribable Action
- SCP-4263-J - Googly Eyes
- SCP-4297-J - Normal Australian Wildlife
- SCP-47-47-J - Rusty the Wonder Dog
- SCP-4800-J - The One True God
- SCP-5040-J - Stripèd Gangs
- SCP-5150-J - Think Of The Children
- SCP-5200-J - JUST SAY NO!!!!!!!!
- SCP-5280-J - Antiquated Measurement System
- SCP-5417-J - The Deadly Nackle
- SCP-5846-J - Author's Commentary
- SCP-6000-Jay - The Great Gatsby by F. Scott Fitzgerald
- SCP-6009-J - HerbiVore!? I Barely Even Know Her!
- SCP-6132-J - Terrain Fumble
- SCP-6140-J - The Br*tish Empire
- SCP-6269-J - The Multiversal Fishing Machine
- SCP-6283-J - Standard Foundation Procedure
- SCP-6395-J - [untitled fish article]
- SCP-7007-J - Subs Only!
- SCP-7143-J - THE KNOB
- SCP-7394-J - HILARIOUS FARTING FROG CLICK NOW TO SEE
- SCP-7475-J - Turbo Shark Pulverizer 6000
- SCP-7560-J - Deccadence, Being the Writings of Wisest RESEARCHER Frank Gene Decray
- SCP-7789-J - There are so many possible puns for this! Some are too phon-ny and others won't fly.
- SCP-7800-J - The Five-Second Rule
- SCP-8003-J - Why Bother?
- SCP-80RK-J - Unfortunately The Best Doggo
- SCP-8231-J - Super Flying T-Rex
- SCP-8851-J - Super Cheap Procedures
- SCP-9999-J - Ground Beef
- SCP-19316-J - Improper Terminology
- SCP-99826-J - The Mind Screw
- SCP-41D3N73-J - Lotsa Pasta
- SCP-649-2568-J - Technicolor Geography
- SCP-1347-1353-J - What a Pestis
- SCP-32-J - The Criminal
- SCP-BLANK-J - Curse You, Antimemetics!
- SCP-CASH4D-J - The People Person
- SCP-COOL-J - A Really Cool Guy
- SCP-Ducks-J - KILLER SALES AT SITE-19!!!
- SCP-HR009-J - Eye-Grabbing Clickbait Title
- SCP-Jaguar-J - Junior Researcher Hutchins' Incredible Automobile
- SCP-L135-J - Very Powerful Psychic Man
- SCP-META-EX-J - Please Don't Coldpost
- SCP-META GUN-J - Guns Pointed At The Balls Of God
- SCP-MWT-J - [SELF-PROPAGATING DANGER]
- SCP-O5-J - Sorry, I do not understand the command.
- SCP-PU1P-J - A PULPy Machine
- SCP-ROCKS-J - A Pile Of Rocks That Need To Shut The Hell Up
- SCP-SAFE-J - Some safes
- SCP-SPC-J - "Shark" "Punching" "Center"
- SCP-SPDR-J - Arachnophobic Colleague
- SCP-sqrt(-1)-J - SCP-
\sqrt{-1}-J - SCP-SQYD-J - Sqyd Game
- SCP-TLDR-J - An Easily Digestible Document
- SCP-V1L3-J - A VILE Machine
- SCP-WCPGW-J - You're Thinking Too Much
- SCP-WOW-J - Dr. Fynegan and Agent Forelli's Bizarre Adventure
- SCP-@#%&!-J - Titters The Talking Bird
Фрагмент списка для редактирования
- SCP-726-EX - The Dowsing Rod
- SCP-1337-EX - NFTs by Vikander-Kneed!
- SCP-1401-EX - Have You Been Scrombled?
- SCP-1512-EX - 3D Bioprinting
- SCP-1551-EX - Señor Pig
- SCP-1927-EX - Farnsworth Effect
- SCP-1964-EX - A Massive Problem
- SCP-2001-EX - M̸̮͂a̸͎͋m̶̙̀a̷͖͗n̷̈́ͅ,̴̭͊ ̴͖̃Ẃ̶͈h̷̤͘y̷͍̚ ̴̞͒D̵͖̀o̴̞̔ḙ̶͐ṣ̸̏ ̸̡̌M̷͔͗ỵ̷̚ ̶̀͜H̷͙͒e̶̟͆ä̸̪́d̷̝͗ ̵̻̀H̴̭́û̴̡r̸̛̹t̷̤̆?̶̧̾
- SCP-2011-EX - Temporary Secretary
- SCP-2023-EX - Capable Athletes
- SCP-5054-EX - The Memetic Myth of Joe Who?
- SCP-5297-EX - ROUGH DRAFT EDIT FOR BREVITY DO BY THURSDAY
- SCP-5735-EX - "Mystery 32" (2104)
- SCP-6192-1-EX - Mirror Inspection
- SCP-7000-EX - Awesome Points™
- SCP-7525-EX - The Slot Goblin

