SCP Foundation

Фрагмент списка для редактирования

Корейский филиал

• Codename: scka - Defense mechanism
• Codename: L.H. Sein - By people
• SCP-002-KO - Xianess' fountain
• SCP-003-KO - Farmhouse
• SCP-004-KO - Eraser Phenomenon
• SCP-005-KO - Mush-Room
• SCP-006-KO - Killer Bed
• SCP-010-KO - Honest Scam Calls
• SCP-011-KO - The Sleeping Giant
• SCP-014-KO - Ask Anything
• SCP-021-KO - The sage's book
• SCP-022-KO - The magnifying glass
• SCP-033-KO - Print Foundation Documents With Caution
• SCP-034-KO - Wolf Flower
• SCP-048-KO - Science Club
• SCP-049-KO - The Black Parade
• SCP-050-KO - About SCP-050-KO
• SCP-056-KO - ［ WARNING: DO NOT READ THIS PAGE! ］
• SCP-064-KO - Seoul Cinematic Production
• SCP-072-KO - Absolute Taste
• SCP-077-KO - The Bermuda Triangle Underwear
• SCP-079-KO - Containment-longing Shuttles
• SCP-086-KO - Knives for Vegans
• SCP-111-KO - A Small Error
• SCP-112-KO - "Dog" Soju
• SCP-113-KO - Eternal Thursday
• SCP-114-KO - LED Fen Fire Flies
• SCP-115-KO - "Meaningless" Regular Polyhedron
• SCP-118-KO - The Savior of All
• SCP-132-KO - Bawling Bamboo
• SCP-137-KO - The Bad Land
• SCP-149-KO - CC BY-NC-ND
• SCP-153-KO - Read me before read below
• SCP-154-KO - Read me before read above
• SCP-157-KO - No time to go to the toilet
• SCP-159-KO - Peach Blossom Land
• SCP-168-KO - Stir-fry?
• SCP-169-KO - The Volition Wins The Day
• SCP-171-KO - Forgotten Music
• SCP-185-KO - Visual Novel
• SCP-188-KO - Heart of the Earth
• SCP-189-KO - Dark alleyway
• SCP-212-KO - Rusty Spade
• SCP-217-KO - USS Enterprise
• SCP-222-KO - A Train in Flames
• SCP-229-KO - Quadrennial
• SCP-234-KO - Doing Dootie Duty
• SCP-268-KO - STRUCTURE ERROR
• SCP-299-KO - A Murder of Crows
• SCP-310-KO - Foods From That Far Place
• SCP-321-KO - Fade-in Virus
• SCP-326-KO - Natural reality fixation
• SCP-345-KO - The Space Hero
• SCP-380-KO - Now the test begins.
• SCP-412-KO - [DATA NOT EXPUNGED]
• SCP-416-KO - There is an instrument buried under the oak tree.
• SCP-432-KO - The Child Gifted With Immortality
• SCP-444-KO - Avici
• SCP-499-KO - The real "BGM"
• SCP-500-KO - The only cure
• SCP-503-KO - Normalcy Classification System
• SCP-505-KO - The Schoolbag
• SCP-521-KO - What is Seeing?
• SCP-545-KO - The Non-Flying Dutchman
• SCP-602-KO - I want to be myself for once
• SCP-621-KO - I will live in ██
• SCP-650-KO - The Duty to Stop All Sin and Unhappiness On This World
• SCP-689-KO - Fangi
• SCP-702-KO - Grownups Don't Know
• SCP-709-KO - Dismembered Eternity
• SCP-713-KO - Gods of the Flying House
• SCP-750-KO - Revenant Soldier
• SCP-755-KO - Learn all the technology and knowledge you want; there are Other Important Things
• SCP-774-KO - Planet Indra
• SCP-797-KO - Skyfall
• SCP-809-KO - Along the thorny vines
• SCP-817-KO - Flame of Love
• SCP-819-KO - Open the Curtains, Lights on
• SCP-824-KO - 22×6×10²³ drops of water
• SCP-825-KO - Sokcho Tongkeun Mulhoe Restaurant
• SCP-826-KO - Homo Sapiens
• SCP-827-KO - It's Beginning to Smell a Lot Like Christmas Everywhere I Go
• SCP-828-KO - A Door Locked from the Inside
• SCP-829-KO - MAD man
• SCP-830-KO -          's slippers
• SCP-841-KO - Supervisor: Antimeme Expert Lee Hanseok
• SCP-876-KO - Head Siren
• SCP-877-KO - B████d B████s
• SCP-890-KO - Here be We, the Consequence of Your Actions
• SCP-897-KO - [ASMR] Dentistry / Teeth Extraction Relaxing Sound
• SCP-903-KO - Not Steroids!
• SCP-916-KO - Perfectly Replaces the Biological Patriarch
• SCP-923-KO - The Anti-Disney Department
• SCP-953-KO - Pretending Humanoid
• SCP-973-KO - Man With Gun
• SCP-980-KO - Cloudy with a Chance of People
• SCP-997-KO - The Edge of Esotery
• SCP-516-KO-EX - [DATA REDUCED]
• SCP-7891-KO-EX - Amnestic Mushroom
• SCP-001-EX-KO-J - A Bad Boy
• SCP-1004-KO-J - Girls' Magic Wand
• SCP-none-KO-J - It's an annoying clothes hanger!

Китайский филиал

• CODE NAME: Darkequation - Bamboo Scroll
• CODE NAME: Anglia - Dragon Vein
• CODE NAME: Veleafer - 演绎部
• CODE NAME: Re_spectators - Substitution Reaction
• SCP-CN-009 - Question, Solve, Answer
• SCP-CN-010 - Aye-aye
• SCP-CN-026 - No Longer be Alone
• SCP-CN-048 - A Failed Attempt
• SCP-CN-066 - OMG! What the Foundation Has Failed to Do for 20 Years Was Done by SCP-CN-066 in Just 4 Seconds…
• SCP-CN-096 - "Stop" "Door"
• SCP-CN-111 - The Solitary Venerable One
• SCP-CN-114 - Pine of Awakening Smoke
• SCP-CN-121 - The Badge of Dr. Sun Yat-sen
• SCP-CN-, 00122 - Fifthist Memetics
• SCP-CN-145 - Hometown
• SCP-CN-161 - Interpreter
• SCP-CN-166 - Embryos
• SCP-CN-171 - Dormitory Manager
• SCP-CN-176 - Uncle Sweets
• SCP-CN-180 - SPEEDCORE GENERATOR!!!
• SCP-CN-204 - Thunder Trial
• SCP-CN-233 - Dot Matrix
• 丂匚卩 句丹丂卄 匚几 句丹丂卄 丅山口 几丨几乇 丂丨乂 - 卄丹几乙丨 从乇从乇
• SCP-CN-312 - What Does She Know?
• SCP-CN-326 - In Fading Books A Digital Music Fantasy Is Reborn
• SCP-CN-366 - Exist
• SCP-CN-369 - Self-Declaration Rostrum
• SCP-CN-404- Memetic Immunity Disease
• SCP-CN-412- Beauty Camera
• SCP-CN-440- Immortals of the Table
• SCP-CN-444 - Heavenly Sounds
• SCP-CN-445 - A Failed Anomalous Document
• SCP-CN-475 - Entombing
• SCP-CN-514 - Insomnia
• SCP-CN-529 - No Longer Human
• SCP-CN-534 - Mr. Dialect
• SCP-CN-546 - Our Secrets
• SCP-CN-661 - Dick, St. Dick
• SCP-CN-666 - Hold the Bottom Line
• SCP-CN-673 - A bunch of statues what move when you dun look at dem
• SCP-CN-675 - The Great Kyet Khaewt Device
• SCP-CN-678 - Stranger
• SCP-CN-713 - Keyboard Fish
• SCP-CN-717 - Throat Forest
• SCP-CN-731 - Black Sunset
• SCP-CN-756 - Book of Numbers
• SCP-CN-757 - Tiny World
• SCP-CN-758 - Mini-Foundation
• SCP-CN-767 - Chart Syndrome
• SCP-CN-797 - The Wandering Train
• SCP-CN-805 - Magic: The Gathering
• SCP-CN-810 - "Gold Foil"
• SCP-CN-829 - Spherical Potatoes
• SCP-CN-844 - The Seed of Lovesickness
• SCP-CN-861 - The pedestrian in a painting
• SCP-CN-879 - Programmable Office Building
• SCP-CN-918 - Ever-Drifting Paper Plane
• SCP-CN-937-J - A Useful Toilet
• SCP-CN-964 - I'll turn on the Bluetooth and listen to some tunes
• SCP-CN-985 - Exam Shark
• SCP-CN-999 - Spreading Your Wings
• SCP-CN-1000 - 2300
• SCP-CN-1001 - Writing Ends Here
• SCP-CN-1050 - "Aquarius"
• SCP-CN-1076 - "Have another bottle"
• SCP-CN-1080 - A Silent Bell
• SCP-CN-1099 - Tin of Sardines
• SCP-CN-1123 - CTTGGGAGATGAATAGATGGGTTGCAACCCATCTATT……
• SCP-CN-1138 - Anime Must Be Destroyed
• SCP-CN-1145 - A Nonexistent Elevator
• SCP-CN-1174 - Royal Quiet Deluxe Typewriter
• SCP-CN-1256 - SCP Foundation Chinese Branch Chronicle
• SCP-CN-1260 - Origin of Species, or Machinery of Creation
• SCP-CN-1276 - "Zekkōchō Conveyor Belt Sushi Restaurant!"
• SCP-CN-1391 - hamster pill by dado
• SCP-CN-1409 - 4200006200
• Work Notes: SCP-CN-1417
• SCP-CN-1424 - not spicy mouthwash by dado
• SCP-CN-1463 - Catgirl Training Plan
• SCP-CN-1483 - Those distant, cold stones
• SCP-CN-1500 - pʰoʃma
• SCP-CN-1537 - Storytelling
• SCP-CN-1604 - A Gun That Gets More Powerful As It Kills More People
• SCP-CN-1621 - become cat pill by dado
• SCP-CN-1666 - Veilbreak
• SCP-CN-1691 - A machine looking for loved ones
• SCP-CN-1733 - The Empty Patches of Sky
• SCP-CN-1767 - What is Papa's Mama Called?
• SCP-CN-1780 - Red Light, Green Light
• SCP-CN-1831 - Human-repelling Incense
• SCP-CN-1835 - The day the music died. Except for you.
• SCP-CN-1837 - USB Sword
• SCP-CN-1920 - J-Q-X, three brothers, see fish eyes and dig them out
• SCP-CN-1976 - Little Red Book
• SCP-CN-1987 - Plunger
• SCP-CN-1997 - When Magic and Science Intersect
• SCP-CN-2019 - Forbidden Borderline Θ
• SCP-CN-2035 - Terminal Entertainment!
• Riddle-2109: God
• SCP-CN-2176 - Zero-Calorie Biscuits
• SCP-CN-2200 - Hyper Dimension Action
• SCP-CN-2215 - A Literary Opinion
• SCP-CN-2227 - Drunk Alone
• SCP-CN-2270 - Rainbow Mount
• SCP-CN-2300 - 1000
• SCP-CN-2304 - The Sun is Tired of Rising
• SCP-CN-2345 - Memory-Carrying Enoki
• Observation File #CN-2380 - When Spring Comes
• SCP-CN-2399 - Still Raining
• SCP-CN-2401 - Sick Hall
• SCP-CN-2402 - The Star Nearby
• SCP-CN-2403 - Dodgeball
• SCP-CN-2405 - Ronald McDonald
• SCP-CN-2406 - … would much rather have KFC!
• SCP-CN-2426 - McNugget Fundamentalism
• SCP-CN-2440 - A video of torturing tubers
• SCP-CN-2517 - A Man Who Cannot, In Fact, Fly
• SCP-CN-2620 - Birthday
• SCP-CN-2626 - D4C
• SCP-CN-2631 - Aliens Speaking English
• SCP-CN-2636 - MTF-己申-20 ("We")
• SCP-CN-2740 - Addictive Minecraft, Sentient NPCs, Digital Lies, Longing for Reality
• SCP-CN-2752 - I See the Machine Core Before the Mechanical Revolution
• SCP-CN-2781 - Before Sleeping
• SCP-CN-2806 - Slickness
• SCP-CN-2835 - Where am I?
• SCP-CN-2878 - Very Annoying Mosquitoes
• SCP-CN-2879 - Very Big Strainer
• SCP-CN-2880 - Very Sharp Sword
• SCP-CN-2918 - The Pleasant Sound of Rain
• SCP-CN-2926 - Big Prime Number
• SCP-CN-2980 - Your Copper Sulfate Friend
• SCP-CN-2987 - Don't Look Up
• SCP-CN-2989 - DEMONSTRATION OF THE PRECENCE
• SCP-CN-2991 - Why disbelieve ye in the revelations of Anormaly, when ye bear witness
• SCP-CN-116-EX - A Dazzling, Lively Relic
• SCP-CN-3300-EX - The Lamb has Died
• SCP-CN-123-J - How Many Urinals Do We Need?
• SCP-CN-213-J - The Magical Geoduck
• SCP-CN-404½-J - "The Foundation is FAKE!"
• SCP-CN-421-J - The Great Radish
• SCP-CN-555-J - Hurts Like Hell!
• SCP-CN-666-J - Mew Mew Mew
• SCP-CN-963-J - Extremely Annoying Codes
• SCP-CN-1616-J - WTF YOU SAID YOU DIDNT REVIEW
• SCP-CN-2000-J - Foundation's Bizarre Black-Technologies
• SCP-CN-2719-J - "Waifu"

Французский филиал

• CODE NAME: Dr. Gray - Not all angels have wings
• CODE NAME: Dr. Johannes - Program Xibalba
• SCP-014-FR - Agent of Chaos
• SCP-021-FR - Lights of the Cliffs
• SCP-027-FR - "Get Rick Rolled"
• SCP-031-FR - The Knowledge-Eaters
• SCP-043-FR - Blind Wanderer
• SCP-045-FR - Thieving Arthropod
• SCP-059-FR - Blizzard's Claws
• SCP-060-FR - The Lich
• SCP-061-FR - The Kiwi
• SCP-073-FR - Biological Sterilizer
• SCP-089-FR - The Athena Project
• SCP-095-FR - The Demon Core
• SCP-113-FR - Infected file S.O.S. - Dr. Anton Vehan
• SCP-116-FR - Trabant 601 S "Hermes"
• SCP-125-FR - Mark IV
• SCP-137-FR - The One True Religion
• SCP-143-FR - Mesozoic chicken coop
• SCP-150-FR - Vox
• SCP-155-FR - Wake up
• SCP-161-FR - The Book And The Beast
• SCP-164-FR - Creationism
• SCP-172-FR - "Points of View"
• SCP-181-FR - Non-recyclable
• SCP-185-FR - Kinetic Inverter
• SCP-192-FR - Your question
• SCP-197-FR - Gardener Tortoises
• SCP-198-FR - Considerations on the Causes of the Greatness of Mankind and its Decline
• SCP-201-FR - Mind Palace Syndrome
• SCP-213-FR - The Vagabonds of the Dark Forest
• SCP-215-FR - Industrial Sardine
• SCP-218-FR - The Antiquity Manufacturer
• SCP-227-FR - Horoscomaton®
• SCP-233-FR - The Pillow That Makes You Sleep
• SCP-237-FR - Absurd Instability
• SCP-281-FR - The Day The Earth Stopped Being Flat
• SCP-291-FR - Containment Procedures Updated
• SCP-296-FR - Dusk on Mars
• SCP-299-FR - 113-B
• SCP-320-FR - Life is a pillow
• SCP-324-FR - He Died Thrice
• SCP-327-FR - Foresight Cameras
• SCP-335-FR - Lacrymodjinn
• SCP-347-FR - Risky Driving
• SCP-361-FR - Matriarch
• SCP-375-FR - Proof of the existence and uniqueness of the Self
• SCP-400-FR - She's Too Beautiful to be True
• SCP-403-FR - Güiro in Exile
• SCP-418-FR - Maurice the Concept-Eating sheep
• SCP-445-FR - Monkey See, Monkey Shoot
• SCP-466-FR - The Cottage Pottage
• SCP-471-FR - Riders on the Storm
• SCP-476-FR - Molecular Voodoo Dolls
• SCP-484-FR - Billy the Euc-kid
• SCP-503-FR - An Imperfect Allegory
• SCP-505-FR - Before Aleph
• SCP-510-FR - 5 Stars
• SCP-540-FR - The Grass is greener
• SCP-555-FR - The SCP Religion
• SCP-569-FR - Dimensional gloryhole
• SCP-589-FR - The Lamppost Song
• SCP-192-FR-J - Chicken that runs like really really fast
• FCP-676-FR-Vay - Exftremely Danverouf Viruf
• SCP-1054-FR-J - Schisms
• SCP-SKIP-FR-J - Skip For Long Optimal Multifunction Whiteness ©

Польский филиал

• CODE NAME: ZeroStrider — Wingless Birds
• SCP-PL-007 - Happily nonexistent object
• SCP-PL-023 - Written World
• SCP-PL-030 - The Mulch
• SCP-PL-037 - The Haunter
• SCP-PL-052 - Subtemporal bracer
• SCP-PL-057 - Leccinum Disappearing
• SCP-PL-066 - Trapdoor in a storeroom
• SCP-PL-067 - Dog that traveled in time
• SCP-PL-078 - Earrings of Instant Meetup
• SCP-PL-086 - I know about the Foundation
• SCP-PL-091 - Calcumuttons
• SCP-PL-144 - Analogue Virtual Reality
• SCP-PL-149 - The Cinema
• SCP-PL-150 - On vacations
• SCP-PL-152 - Pet snakes
• SCP-PL-160 - Fat Burner
• SCP-PL-166 - Cemetery lights
• SCP-PL-173 - Fungal sounds
• SCP-PL-174 - R'EALITYBLENDER™
• SCP-PL-180 - Those who embark with us
• SCP-PL-183 - Lust of Speed
• SCP-PL-186 - Art is Death
• SCP-PL-195 - Gift from a friend
• SCP-PL-200 - Responsible Reading
• SCP-PL-203 - Weather for 2033
• SCP-PL-204 - How to Disappear Completely and Never Be Found
• SCP-PL-213 - Gloria Necatis
• SCP-PL-231 - The Wrath of Perun
• SCP-PL-248 - Heraclitic Tears
• SCP-PL-253 - WHAT IN THE KENTUCKY FRIED FUCK
• SCP-PL-259 - The list of territories conquered by Genghis Khan is incomplete, you can help by expanding it
• SCP-PL-260 - We know where you live
• SCP-PL-262 - A
• SCP-PL-267 - Mieszko, Mieszko, mój koleżko
• SCP-PL-284 - Oh God, oh fuck
• SCP-PL-289 - A Multidimensional Solution For Shopping at Biedronka
• SCP-PL-290 - Empiricism
• SCP-PL-121-J - Diego the Turtle
• SCP-PL-2004-J - The very fast vehicle of anthropomorphic amphibian
• SCP-PL-2021-J - The hope for our world
• SCP-PL-6470-J - Cat meme [DANGEROUS]

Испанский филиал

• CODE NAME: Uncle Nicolini - The Nexus of Babel
• SCP-ES-038 - The Bussinesman
• SCP-ES-039 - Satellipeople
• SCP-ES-040 - Polaris Leporidae
• SCP-ES-044 - Necrofauna Arthropoda
• SCP-ES-048 - The Power of Ideas
• SCP-ES-054 - The Garden Gnome Gardeners
• SCP-ES-058 - Stilhed Overalt; Silence Everywhere
• SCP-ES-059 - Thirteen Little Fingers
• SCP-ES-069 - The Twine upon the Fate of her Appeal to Look
• SCP-ES-070 - Narcissus and the Plain of the Arrows of Eros
• SCP-ES-076 - https://www.youtube.com/watch?v=fgm14D1jHUw
• SCP-ES-081 - Gluttony
• SCP-ES-083 - deCipher'em All v1.6
• SCP-ES-087 - Sandbox; Intentional Continental Drift; I don't know biology so I'll turn fish into birds.
• SCP-ES-089 - The Last Emperor of Hoiohiña
• SCP-ES-090 - Nine Lights Emissary
• SCP-ES-091 - Eugenics Nightmare
• SCP-ES-095 - A Victimless Crime
• SCP-ES-096 - THE GALLEON, or; Hunt the Dutchman! Or; The Assfuckedship
• SCP-ES-097 - Fungi Reactor
• SCP-ES-098 - Kynodontos
• SCP-ES-099 - The Piano Concert
• SCP-ES-100 - For Your Safety, Please Use the Stairs
• SCP-ES-101 - Ye Shall Not Worship False Gods
• SCP-ES-102 - The Cage
• SCP-ES-103 - Frustrated Musician
• SCP-ES-105 - Stargazing The Other Stars
• SCP-ES-107 - Partnercaller3000
• SCP-ES-111 - An explorer fallen from somewhere else
• SCP-ES-112 -  🤑🔫 pay 2 win 🔫🤑
• SCP-ES-113 - Special Deal
• SCP-ES-115 -  This is the Metro of Franco's Spain
• SCP-ES-116 - A Gossiper Gramophone
• SCP-ES-117 - A second chance
• SCP-ES-119 - The Ministry of Abnormalities of Cuba
• SCP-ES-120 - This Sickness Will Not Defeat Me
• SCP-ES-122 - greatGreenishGreenery v1.01
• SCP-ES-123 - Aurus Trading Company
• SCP-ES-125 - North Korean Orbital Bombardment System
• SCP-ES-132 - The Wall; The Selective; The Thing That Kills You; We Don't Let Fools In; The Witch Burning; The Booby Trap; Stress; These Fools Don't Learn; We Have The Key; The Key; I Need Sleep; Sometimes, A Break; Sometimes, A Life; Merlín
• SCP-ES-133 - The Green One always finds its way
• SCP-ES-136 - Penitent Cry
• SCP-ES-137 - Sadness
• SCP-ES-142 - The Bones of the Saints
• SCP-ES-143 - May the Light of St. George lead us to Victory
• SCP-ES-145 - Funerary Licentiousness
• SCP-ES-146 - Who am I?
• SCP-ES-147 - Cessation of Legacy
• SCP-ES-152 - The Fall of the Fools
• SCP-ES-157 - Coppélia
• SCP-ES-158 - And the Potatoes Took Over the Earth
• SCP-ES-163 - Elephant Graveyards
• SCP-ES-165 - Kaiju Sarcophagus
• SCP-ES-169 - The Hentai Dream Made True
• SCP-ES-173 - The last sacrifice to Vulcan
• SCP-ES-178 - The best re-union you will never have.
• SCP-ES-180 - It's not yours, it's ours
• SCP-ES-181 - The King Who Burnt
• SCP-ES-184 - Vitrified Fortresses
• SCP-ES-185 - Space Swallow
• SCP-ES-186 - Absolute Corruption of Power
• SCP-ES-191 - Stellar Garden
• SCP-ES-193 - On the 13th of April, 2013, a Train Fell From the Sky
• SCP-ES-194 - That motherfucker Fidel Castro just won't stay dead!
• SCP-ES-196 - Buried Dreamers
• SCP-ES-199 - Institution for Dealing with Your Issues of Normalcy
• SCP-ES-200 - Mind Control Ball Cactus
• SCP-ES-201 - Theatrum Mundi
• SCP-ES-202 - What is HANSARP?
• SCP-ES-203 - Super Golden Fruit
• SCP-ES-208 - Flying Pigs
• SCP-ES-216 - Lutiya, Pillar of Silence
• SCP-ES-220 - Burning Soul
• SCP-ES-230 - EAGLE Protocol
• SCP-ES-232 - Gramophone Gal (Do You Like Gramophones?)
• SCP-ES-234 - Detective Marw, Private Eye
• SCP-ES-245 - Autarchy of Atonement
• SCP-ES-250 - First Parca: Sons of the Harvest
• SCP-ES-251 - Second Parca: Tales of Misery
• SCP-ES-252 - Third Grim Reaper: The Life of Death
• SCP-ES-256 - At midnight
• SCP-ES-260 - The Blue Eyes of Gea
• SCP-ES-261 - The taste of the stars and the desolation of Juno
• SCP-ES-262 - RAVEYARD
• SCP-ES-264 - A Friendly Crab
• SCP-ES-266 - Scavenger Jellyfish
• SCP-ES-268 - Electromagnet-shrooms
• SCP-ES-284 - A, last? regret
• SCP-ES-288 - Who is that walking beside you?
• SCP-ES-290 - Wrong Taxi
• SCP-ES-296 - The Path From Which We Come From
• SCP-ES-297 - 🌮🔔
• SCP-ES-100-EX - Mother Nature
• SCP-ES-112 Extended Testing Log
• Document-ES-061-B
• SCP-RU-178 - The Heroes Of Vólorovsk
• Proposal by Nico, Who Has Gone A Little Crazy
• SCP-ES-I don't care-J - I don't care
• SCP-ES-050-h2o-J - Bears are better than crocodiles. Probably.
• SCP-ES-101-J - The Hard-To-Open Container
• Emily Miranda Sends Nudes

Тайский филиал

• CODE NAME: DrSSS - Another World Comers
• SCP-009-TH - Human Anatomy Model
• SCP-043-TH - Human Ice Cream
• SCP-072-TH - The Castle Guards
• SCP-400-TH - The Elephant is a Blood-thirsty Animal
• SCP-412-TH - The Lattice (The Hydrologic Cycle)
• SCP-747-TH - The Black Box
• SCP-901-TH - The Giant Head
• SCP-903-TH - Very Huge Dinosaur
• SCP-025-TH-J -  Stop for Inspection Sign
• SCP-222-TH-J - The Troll Cat The Genius Hacker Cat

Японский филиал

• CODE NAME: solvex - Acquittal and Miniascape
• CODE NAME: amamiel - Ave Maria
• CODE NAME: indonootoko - Arahitogami
• CODE NAME: k-cal - The Balance Scales The Handover Report You Want
• SCP-010-JP - "Mirai PC"
• SCP-017-JP - Local Rules
• SCP-020-JP - Winged Human
• SCP-023-JP - Shadow Railway Line
• SCP-030-JP - Petroleum Devourers
• SCP-043-JP - Seasoning that Makes Anything Edible
• SCP-047-JP - "For the Greatest Music"
• SCP-065-JP - from today on i am the prime minister All We Need Is Dominator
• SCP-076-JP - Terror Overhead
• SCP-082-JP - To the Desired Country
• SCP-086-JP - Zombie Virus
• SCP-088-JP - Babies Can Choose Their Moms and Dads to Be Born to
• SCP-094-JP - Marine Man
• SCP-095-JP - Satō Saitō
• What is SCP-105-JP? I've investigated it in my own way!
• SCP-115-JP - Nue
• SCP-120-JP - The World's Most Valuable Jewel
• SCP-132-JP - One Fish, Two Fish, Paper Fish, Silverfish
• SCP-167-JP - Restaurant Seashore
• SCP-181-JP - Effective Advertising
• SCP-184-JP - Worn-Out Utility Pole
• SCP-194-JP - Paradise Inside a Memory
• SCP-199-JP - Another Audience
• SCP-266-JP - A Town Without Anyone
• SCP-268-JP - The Never-Ending Epic
• SCP-272-JP - "Floora"
• SCP-277-JP - Feigning Death Tank
• SCP-333-JP - The Earthlings
• SCP-359-JP - Penguin Mushroom
• SCP-373-JP - Manufacturing Group
• SCP-398-JP - Eternal Room 105
• SCP-407-JP - A Tub
• SCP-419-JP - An Alternate History of Easter Island
• SCP-444-JP - █████[ACCESS UNAUTHORIZED]
• SCP-475-JP - I Want to See Only Beautiful Things
• SCP-496-JP - Warning: Electronic Protocol in force when viewing this document
• SCP-522-JP - Airborne Baguette Concentration Measurement Station
• SCP-534-JP - Get a Glass for Flea
• SCP-546-JP - Sugar and Spice and All That's Nice
• SCP-548-JP - Singing Rain Sounds
• SCP-557-JP - Déjà Mort
• SCP-558-JP - Bunch o' Chicks 'n' BIG MAMA
• SCP-569-JP - Konpeight
• SCP-571-JP - NIGIRI OF THE DEAD
• SCP-583-JP - Darkness of the Remembrance
• SCP-586-JP - Snow Globes Past the Sell-By Date
• SCP-588-JP - Transdimensional Buttock Wall ~ A Karcist's Ass Sticking Out Into Our Universe ~
• SCP-632-JP - Human Internal Ants
• SCP-646-JP - A Retro-bender
• SCP-654-JP - Matryoshka
• SCP-656-JP - Human Repellant Plastic Bottles
• SCP-671-JP - The Night of Electric Jellyfishes
• SCP-682-JP - Tough Microbe
• SCP-737-JP - Merciful Jewelry Workshop
• SCP-747-JP - How To Boil Some Eggs In This Shifting Universe
• SCP-751-JP - EVERYBODY,FUCK YOU
• SCP-787-JP - How Those Vacuous Spines Got So Close To You
• SCP-818-JP - How great-
• SCP-828-JP - Launching Site
• SCP-830-JP - Downfall of One Night Castle
• SCP-831-JP - Lurking Summer
• SCP-835-JP - Xenophobia Keteru Yamiko
• SCP-838-JP - Urban Waves
• SCP-903-JP - Mr. Kojirō feat. Joyful Dancers
• SCP-905-JP - Freddie’s Special Flight Show
• SCP-918-JP - That's Someone else's Lost Dreams
• SCP-922-JP - Animal Relocation
• SCP-926-JP - Oneiric Eternal Recurrence Of The Nightmare Beast
• SCP-949-JP - Overrunning Bulldozer
• SCP-981-JP - Wenkankanhoyaukamuy
• SCP-1012-JP - Inversive Monotony
• SCP-1020-JP - Feeding Bowl for Chucky
• SCP-1044-JP - For Those Who Will Listen
• SCP-1045-JP - Corrective Lenses
• SCP-1078-JP - Less Guilt-Provoking Laboratory Organisms
• SCP-1100-JP - CAPTCHA
• SCP-1118-JP - Tokyo DisneySky
• SCP-1134-JP - Explosive Nigiri Sushiblade
• SCP-1139-JP - Electronic Diva
• SCP-1201-JP - Lakebed Electronics Store
• SCP-1242-JP - Abyssal Toilet Stall
• SCP-1249-JP - People
• SCP-1299-JP - They're All Alive
• SCP-1300-JP - An Offering to S
• SCP-1302-JP - Revolving.
• SCP-1304-JP - The Day the Wild Thistle Fell
• SCP-1305-JP - Infinite Monkey Would Never Abuse Drugs
• SCP-1330-JP - Crackti
• SCP-1332-JP - Mule at the Edge of the World
• SCP-1334-JP - Towards the Beach
• SCP-1357-JP - Kingfisher, Shining As Bright As Fire
• SCP-1379-JP - annoying omnipotent
• SCP-1405-JP - British White Silver Garden
• SCP-1407-JP - Chicks could remember
• SCP-1431-JP - I Really Wanna make them into Moss.min.js
• SCP-1440-JP - と
• SCP-1444-JP - Reenacting Proof for the Sake of Pleasure
• SCP-1475-JP - Target North Carolina!
• SCP-1494-JP - The Roadkill is Always Watching Over Us
• SCP-1495-JP - The Bystander is Only Watching for All Time
• SCP-1548-JP - You Offend My Eyes
• SCP-1566-JP - When the Body Dies, the Mind Also Dies; and When the Mind Dies, the Body Is As Good As Dead
• SCP-1576-JP - Hence the God Exists
• SCP-1577-JP - The Cow Lay Down On The Grass Because It Was So Starving
• SCP-1579-JP - A Man's Neighbor
• SCP-1581-JP - Graveyard is Full of Balloons
• SCP-1646-JP - Everything is in a Dream
• SCP-1657-JP - Eyedrops From the 2↑↑↑↑2nd Floor
• SCP-1673-JP - Moses and the Hot Springs
• SCP-1677-JP - Space Jumper
• SCP-1687-JP - With You, Someday/Eternally
• SCP-1690-JP - Tān, or Ouroboros
• SCP-1693-JP - Birth of the Prison
• SCP-1709-JP - Katana of Poetic Justice
• SCP-1710-JP - CHOPIN GODZILLA
• SCP-1721-JP - Love-Doll Retriever
• SCP-1732-JP - Toutei - Invitation
• SCP-1748-JP - Someday Somewhere
• SCP-1774-JP - Natural Apple
• SCP-1783-JP - The Ship is Full of Rabbits
• SCP-1792-JP - Guillotine Lemonade, Friendly Price 25¢
• SCP-1803-JP - Perpetual Generator, or a Black Box
• SCP-1810-JP - QR Bird
• SCP-1828-JP - Foggy Forest
• SCP-1841-JP - Don't Get Off Your Pedestal
• SCP-1857-JP - Cherry Blossom of Permanence
• SCP-1866-JP - A Job to Save the World
• SCP-1868-JP - Freed Headless Feline Carcasses (they can't go anywhere in the first place, and the neighbors don't give them a shit)
• SCP-1873-JP - Yoke of Flesh
• SCP-1876-JP - Out of Mom
• SCP-1934-JP - Shiba Inu on the Suspension Bridge
• SCP-1936-JP - This Connection Has Been Severed by a Nightmare Collective
• SCP-1944-JP - Unfortunate Flying Object
• SCP-1977-JP - Death Got A Non-Aquaphobic Horse
• SCP-1978-JP - Sailor Suit and Machine Gun
• SCP-1988-JP - Heisei Convenience Store Myths
• SCP-1995-JP - Ushi-Gozen
• SCP-1998-JP - A Girl Who Changes Shape with Extreme Force and a Super Deranged YouTuber
• SCP-2005-JP - Sword of Judgement, Bell of Forgiveness
• SCP-2048-JP - An Ordinary Coin
• SCP-2057-JP - Back to the Egg, Then It Hatches
• SCP-2061-JP - Adventure Tale at Gyouseiya Department Store
• SCP-2077-JP - Turing Shredder
• SCP-2113-JP - And He Closed His Eyes
• SCP-2152-JP - Tranquility, Anxiety, Drinking Down into the Darkness
• SCP-2170-JP - Oneigal Upload
• SCP-2188-JP - Light Fingers with a Ready Tongue
• SCP-2200-JP - BBC
• SCP-2203-JP - Reset
• SCP-2211-JP - Foundation Department of Hell
• SCP-2227-JP - Tell Me Stories
• SCP-2233-JP - He Who Was Mourned By As Many People As Possible
• SCP-2300-JP - Whether I Stay or Not, I May Never Go Anywhere
• SCP-2351-JP - Virtue's Vengeance
• SCP-2371-JP - Soytaurus
• SCP-2403-JP - Invasive Species Throwing Dude
• SCP-2422-JP - Language Kusōzu
• SCP-2424-JP - Lincoln Century
• SCP-2426-JP - Won't You Jump Out At Me From That Corner?
• SCP-2429-JP - Pufferfish Eten
• SCP-2433-JP - Wrongful Indulgence
• SLOT UNALLOCATED - That Which Kills Me
• SCP-2459-JP - It Must Be a Warm Place That Leads to Hell
• SCP-2472-JP - Nyankoderoga
• SCP-2476-JP - cat.exe (Modification Prohibited)
• SCP-2493-JP - Broken Smile
• SCP-2503-JP - Those Who Wait for Absolute Zero
• SCP-2505-JP - Processed Quail
• SCP-2507-JP - Jumpscaring Ghosts
• SCP-2513-JP - At Least, Be the Foundation
• SCP-2566-JP - RETURN PARADOX
• SCP-2580-JP - The Great Death
• SCP-2581-JP - Make Me Look Pretty☆
• SCP-2601-JP - "Me, and Yayoi, and Miyuki, and…"
• SCP-2613-JP - Fear Conditioner
• SCP-2626-JP (SCP-262-IE) - Casadh an tSúgáinTangled Thread
• SCP-2642-JP - Making "Project Arca"
• SCP-2650-JP - Transfeuneral
• SCP-2687-JP - Meaning of Life/Meaning of Death
• SCP-2707-JP - Floral Tribute for Me
• SCP-2733-JP - The Road To Hell Is Paved All Over With Good Intentions, Even Having Information Signs
• SCP-2744-JP - てるてるネコちゃん
• SCP-2755-JP - A Star at the Bottom of a Lake
• SCP-2760-JP - Dazzling with gold
• SCP-2784-JP - Someone is Talking About You Somewhere
• SCP-2788-JP - Your nth Dead Grandma
• SCP-2790-JP - Foundation Department of Retention
• SCP-2833-JP - SKYWELLS: THE SECOND
• SCP-2840-JP - The Room
• SCP-2844-JP - Cognitive Dissonance
• SCP-2851-JP - No Longer Red Needed
• SCP-2855-JP - SKYWELLS: THE FIRST
• SCP-2856-JP - My Hero
• SCP-2880-JP (Unassigned Number)
• SCP-2891-JP - Interstellar Retribution
• SCP-2904-JP - How Many Pigs Have You Ever Murdered?
• SCP-2920-JP - Strangulation Demon
• SCP-2955-JP - Septette for the Dead CN-Aniki
• SCP-2973-JP - The Man with the Most Powerful Abilities Ever
• SCP-2975-JP - "Cuz When I'm Up Late, I Wanna Eat Somethin'"
• SCP-2989-JP - The Star of My Wish Rises in the Clear Blue Sky
• SCP-666-JP-J - The Ultimate Horrible Object
• SCP-999-JP-J - The Tickle Master
• SCP-Shrimp-JP-J - ＞ A saury ＜
• SCP-K2-JP-J - Oh shit !!!
• 5Ç卩-譁?ｭ怜喧縺-JP-J - Untellable
• SCP-014-JP-EX - I Just Wanted to See that Look on your Face

Немецкий филиал

• SCP-009-DE - Cheap Gas
• SCP-015-DE - Dr. Duck
• SCP-017-DE - R.T.I. Grizzly A1
• SCP-028-DE - Sonderkommando for the paranormal
• SCP-030-DE - R.T.I. Hammer P1
• SCP-031-DE - Isabelle
• SCP-034-DE - Shower of dread
• SCP-042-DE - Avoid Containment
• SCP-045-DE - What are you searching for?
• SCP-046-DE - Shuffling Corpse
• SCP-051-DE - Mr. Soother
• SCP-056-DE - R.T.I Sentinel
• SCP-058-DE - Peaceful Zombies
• SCP-066-DE - The little Spellbook
• SCP-070-DE - Pink Colony
• SCP-076-DE - Face-Swap App
• SCP-083-DE - Badge of Physical Fitness
• SCP-087-DE - Confused AI
• SCP-089-DE - The Athena Project
• SCP-090-DE - I‘m SCP!
• SCP-091-DE - The Loving Doll
• SCP-096-DE - A Cosmic Phenomenon
• SCP-098-DE - Demon vs Machine
• SCP-099-DE - Gasmen
• SCP-100-DE - The gargoyle's misdeeds
• SCP-101-DE - Eik, the Tree of Knowledge
• SCP-117-DE - The News of the Day to Come
• SCP-121-DE - Telepathic humanoid
• SCP-122-DE - Frau Harlekina
• SCP-124-DE - Don't notice me
• SCP-125-DE - The Imprisoned Regent
• SCP-131-DE - Real Estate Shark
• SCP-136-DE - The boy who stops time.
• SCP-137-DE - Ice Phoenix
• SCP-140-DE - Morts volantes
• SCP-148-DE - Blue Slime [Level 25]
• SCP-149-DE - The Spirit of Ruin
• SCP-150-DE - Die Verteidiger
• SCP-173-DE - Hating Stones
• SCP-177-DE - The Rungholt Shard
• SCP-178-DE - Dreamlike Weather
• SCP-179-DE - To the most Righteous
• SCP-180-DE - A little cute Birthdaypenguin
• SCP-184-DE - Arachnophilia
• SCP-186-DE - The True Meaning of Christmas
• SCP-187-DE - Mathilda
• SCP-188-DE - B4 “Blitzgewitter”
• SCP-190-DE - Thor, God of Kebab
• SCP-192-DE - "Knowledge"
• SCP-200-DE - Higher Mathematics
• SCP-201-DE - Metal Dragon
• SCP-204-DE - The Chest of Eternity
• SCP-207-DE - The heart of Cupido
• SCP-208-DE - St Caesarius Hospital
• SCP-209-DE - The idiot box
• SCP-226-DE - Knight Cuddle Steel
• SCP-227-DE - Moo
• SCP-234-DE - A Christmas miracle
• SCP-236-DE - A cup of love
• SCP-237-DE - Her heart and his soul
• SCP-239-DE - USB Jird
• SCP-248-DE - Omni fork
• SCP-255-DE - The Perfect Mascot
• SCP-257-DE - A butt ugly owl
• SCP-260-DE - Ahead of her time
• SCP-272-DE - Megalodon
• SCP-281-DE - A pretty good hotel
• SCP-292-DE - Sweet Easter
• SCP-293-DE - Aliens, go home!
• SCP-296-DE - In death we blossom
• SCP-297-DE - Combustible Deep-Sleep
• SCP-299-DE - What the Future Holds
• SCP-004-DE-EX - Repulsive
• SCP-015-DE-J - This is why the SCP Foundation hates Ducks and Geese
• SCP-027-DE-J - The Big Bad Tap Hen
• SCP-033-DE-J - Earworm
• SCP-044-DE-J - This damn schnapps
• SCP-(INSERTANYNUMBERHERE)-DE-J - The Trainee
• The Things Dr Ore Is Not Allowed To Do At The German Branch Of The Foundation

Итальянский филиал

• CODENAME: /GRAF - The Dragon Of Revelation
• CODENAME: /ABAD - The Values Of The Fatherland
• SCP-002-IT - The Voice of the Piave
• SCP-010-IT - Parental Care
• SCP-011-IT - The Zero Zone
• SCP-012-IT - Waltz No. 2
• SCP-013-IT - Sentient Tornado
• SCP-015-IT - The Boogeyman
• SCP-017-IT - Sentient USB Pendrive
• SCP-018-IT - EMP Barn Owl
• SCP-019-IT - E-15 Chimera
• SCP-020-IT - Horse with Oratory Skills
• SCP-021-IT - The Capitoline Wolf
• SCP-022-IT - Legion
• SCP-023-IT - Hounds of the Dictator
• SCP-024-IT - Rebar ಉ
• SCP-025-IT - Kangaroo Mother
• SCP-029-IT - The Last Vestal
• SCP-032-IT - Haruspex
• SCP-035-IT - The Hammer
• SCP-037-IT - Subtle Vibration
• SCP-038-IT - Ocean Stones
• SCP-039-IT - Cordless Telephone
• SCP-041-IT - A Flat World
• SCP-042-IT - The Answer
• SCP-045-IT - The Hypogea of the Daunia
• SCP-050-IT - The Galleass
• SCP-054-IT - Microcosmos
• SCP-055-IT - The Devourers
• SCP-057-IT - Under the Sea
• SCP-066-IT - Diabolus ex Machina
• SCP-067-IT - The King of the Hill
• SCP-068-IT - Kaliperia
• SCP-070-IT - Forgotten Depths
• SCP-071-IT - Ötzi's cloak
• SCP-079-IT - Locus Amoenus
• SCP-080-IT - Shattered Civilization
• SCP-082-IT - The Helmet of Knowledge
• SCP-100-IT - Carnem Levare
• SCP-103-IT - Ciapapuer
• SCP-105-IT - Anachronistic Hallucinogenic Excrements
• SCP-149-IT - After the End of the Eternity
• SCP-004-IT-ARC - Infinite Tuning Guitar
• SCP-008-IT-ARC - The Hotel
• SCP-014-IT-ARC - XXXIII (Before Rewrite)
• SCP-001-IT-J - The “Dragon” Of Revelation
• SCP-002-IT-J - The Doctor-Destroyer
• SCP-610-IT-J - The Perfect Projectile
• SCP-1900-IT-J - The Pirate Kingdom
• SCP-F2Y-IT-J - The [EXPLICIT]
• Italian Sites -J - The best Sites of the Italian Branch!

Украинский филиал

• SCP-012-UA - The Library
• SCP-035-UA - Tablet of Veles
• SCP-038-UA - Alike to black holes
• SCP-046-UA - Tasty flashbacks
• SCP-049-UA - Apparently… God?..
• SCP-054-UA - Pater noster Bandera
• SCP-056-UA - Pit on the road
• SCP-065-UA - Deliver Us From Evil
• SCP-069-UA - Cast-iron charcoal iron
• SCP-079-UA - No-Sides
• SCP-081-UA - Vanka-Vstanka
• SCP-095-UA - Crazy Bee
• SCP-2014-UA-EX - SCP-2014-RU
• SCP-692-UA-J - Connection cockup

Португальский филиал

• CODINAME: Project Bulwark - by slashannemoo & Vintner
• SCP-002-PT - Women's Magazine
• SCP-003-PT - Silent Droplets
• SCP-004-PT - The Soldier and the Bomb
• SCP-006-PT - Freefalling Nightmare
• SCP-008-PT - Man-Man
• SCP-010-PT - Peppers
• SCP-011-PT - Victoria stella
• SCP-013-PT - Crazy Cyborg's Samba
• SCP-014-PT - Improvised Appearances
• SCP-015-PT - Electromagnetic Cannon
• SCP-016-PT - The Holy Grail
• SCP-018-PT - Unrecorded Man
• SCP-019-PT - Porcelain Dish
• SCP-021-PT - Crystal Theatre
• SCP-022-PT - Lawyers = Fairies and Vice Versa
• SCP-023-PT - Xeno's Paradox
• SCP-024-PT - A Longtime Friend
• SCP-025-PT - Portable Desert
• SCP-026-PT - Sober Drunk
• —————— - This Shouldn't Exist
• SCP-030-PT - Cultural Heritage
• SCP-031-PT - Pocket Imp
• SCP-034-PT - Creator Magnifying Glass
• SCP-035-PT - The Pigeon
• SCP-038-PT - Floating Snake
• SCP-040-PT - Ostium Theater
• SCP-041-PT - A Weapon Among the Stars
• SCP-042-PT - The ████ Opener
• SCP-043-PT - The Player
• SCP-046-PT - Read a Book, Write a Book
• SCP-049-PT - <N0:.WH3RE>
• SCP-050-PT - The Sack Man
• SCP-055-PT - Adaptive Tactical Armour for Containment and Assault
• SCP-057-PT - The Abandoned Hospital
• SCP-065-PT - Hard-to-Kill Armadillo
• SCP-078-PT - The Fog
• SCP-079-PT - Schrödinger's Planet
• SCP-088-PT - This Machine Kills Commies
• SCP-089-PT - I Shall Deeply Love You
• SCP-094-PT - Apamachi Identity Camouflage Device.
• SCP-101-PT - Manor of Madness
• SCP-106-PT - Sonic Flashlight
• SCP-110-PT - A Very Convincing Story
• SCP-118-PT - That Which Shares
• SCP-119-PT - The Pompous Girl
• SCP-122-PT - Factor XX
• SCP-143-PT - Escape from the Rio-Niterói Bridge
• SCP-150-PT - P███ G████´s Progressive Location Pen
• SCP-166-PT - The Light of the Court
• SCP-170-PT - [31/12/2025]: thank you.
• SCP-172-PT - Mother-of-Gold
• SCP-177-PT - Time Travelling Lottery
• SCP-191-PT - Acre's UFO
• SCP-195-PT - Special Gift for Naughty Workers
• SCP-196-PT - Midas Gloves
• SCP-199-PT - Spread the Word
• SCP-033-PT-EX - Dream-Catcher
• SCP-019-PT-J - The Big Ban Hammer
• SCP-045-PT-J - Monsterwave
• SCP-075-PT-J - Good Morning!
• SCP-109-PT-J - The Foundation
• SCP-005-PT-ARC - The Reason Why Dendrophobia Exists
• SCP-012-PT-ARC - Socrates

Чешский филиал

• SCP-017-CS - Absolute Justice
• SCP-023-CS - Why can't he just leave me alone?
• SCP-042-CS - Northern Devil
• SCP-073-CS - The cousin of Winnie the Pooh
• SCP-082-CS - Captive of a frequency
• SCP-087-CS - Splendid Light
• SCP-148-CS - Unfinished Business

Традиционный Китайский филиал

• SCP-ZH-002 - Taiwanese Unicorn
• SCP-ZH-003 - Extreme Religion
• SCP-ZH-004 - Marslow’s Daughter
• SCP-ZH-005 - If you haven't re-shared this article with ten friends, then…
• SCP-ZH-006 - The real meaning of popcorn
• SCP-ZH-037 - Tears from Hawksbill Sea Turtle
• SCP-ZH-038 - The Faceless Model
• SCP-ZH-041 - Dreams
• SCP-ZH-048 - Sword & Sorcery and Tea & Magic Hands
• SCP-ZH-060 - The Deer Road Tunnel
• SCP-ZH-105 - The Unfilials
• SCP-ZH-132 - The 007 Game That Kills You
• SCP-ZH-178 - The Bird Mug
• SCP-ZH-200 - Let's Tag
• SCP-ZH-228 - Tsuipu, 1947
• SCP-ZH-236 - Last Year Syndrome (Senioritis)
• SCP-ZH-251 - Ruins In Third Floor
• SCP-ZH-261 - Cuban Sugar
• SCP-ZH-282 - The Gourmet
• SCP-ZH-310 - Anomalous Protein Domain
• SCP-ZH-446 - Became Bug
• SCP-ZH-526 - I’m Just a Toaster
• SCP-ZH-545 - I'm Not A Dinosaur
• SCP-ZH-617 - The Brave One From the West
• SCP-ZH-618 - Sun Pastry Lion
• SCP-ZH-736 - You Can't Go Any Further
• Mrs. Alicia
• SCP-ZH-860 - dado's Hair/Have-fortune Drug
• SCP-ZH-889 - Beyond This World
• SCP-ZH-973 - As Your Hatred
• SCP-ZH-2005-EX - Internet Celebrity
• SCP-ZH-9288-EX - You are completely aware that you will never meet the person sitting next to you listening to your story ever again.
• SCP-ZH-00l - SCP-ZH-001
• SCP-ZH-60053-J - HONK

Вьетнамский филиал

• SCP-002-VN - Funeral
• SCP-006-VN - The Night Stars
• SCP-012-VN - One Gains, What One Wishes
• SCP-013-VN - Poisonous Milk
• SCP-014-VN - Dream Crayons™
• SCP-018-VN - The Two-Wheeled Hatred
• SCP-024-VN - The Beginning of All
• SCP-033-VN - Rubber Duck
• SCP-036-VN - The Cube
• SCP-040-VN - Those Black Words
• SCP-096-VN - Where the Earth Meets the Tide
• SCP-099-VN - The Waifu Heaven
• SCP-100-VN-J - The True Omnipotent SCP
• SCP-6789-VN-J - A Kettle-Class Loudspeaker

Вход в SCP-4558.

Объект №: SCP-4558

Класс объекта: Евклид

Особые условия содержания: SCP-4558 закрыт для доступа общественности под предлогом размещения воинских частей. Исследования объекта проводятся силами расположенной неподалёку Зоны 312.

Тестирование SCP-4558 и экспедиции внутрь него в настоящее время планируются приостановлены указом О5-5.

Наивысший приоритет имеет наблюдение за Церковью Максвеллизма, особенно за ЛПИ-8161, ЛПИ-8162 и ЛПИ-8163. ЛПИ-8161 сейчас живёт на западе США, места проживания ЛПИ-8162 и ЛПИ-8163 на данный момент неизвестны.

Описание: SCP-4558 — подземный суперкомпьютер, находящийся в пустыне Овайхи, штат Айдахо, США. Точные размеры объекта неизвестны; считается, что он простирается по крайней мере на 2.5км по горизонтали от входа и имеет максимальную глубину залегания около 3км.

Входом в SCP-4558 является небольшой бетонный бункер, расположенный посреди пустыни. Внутри находится лестница, ведущая в камеру «управления», в которой находятся несколько мониторов и устройств ввода информации. С помощью них можно напрямую взаимодействовать с объектом. На потолке камеры выгравирована фраза «МНОГИЕ В НЕСКОЛЬКО». Несмотря на сильные повреждения систем и памяти объекта, он полностью функционален. Информация об остальных частях объекта недостаточна. Ожидается экспедиция МОГ Эпсилон-101 («Четыре Огня»).

Назначение SCP-4558 неизвестно, но многочисленные исследования Фонда показали, что объект разрабатывался Церковью Максвеллизма. Планы постройки похожего объекта были обнаружены в архивных копиях форумов и логах чатов начала 1990-ых годов. Позднее руководство Церкви признало подобные обсуждения «ересью». Выдающимися пользователями, участвовавшими в тех обсуждениях, были: «onewan1», возможный лидер проекта на ранних этапах, «holy_fibr3», сейчас считающийся главным программистом проекта, и «tbgeuse», чьей задачей была разработка «защитных механизмов». Эти люди были обозначены как ЛПИ-8161, ЛПИ-8162 и ЛПИ-8163 соответственно.

Никаких сведений об объекте в период от того момента до обнаружения Фондом, произошедшем 08.12.2015, не обнаружено. Данные, извлечённые из памяти объекта, показывают, что постройка объекта не могла начаться ранее 2005 года.

Приложение 1: Далее представлены отрывки из книги, найденной в камере управления. Из-за меметических свойств разобрать можно лишь данные отрывки.

Приложение 2:  19.08.2015 произошла запланированная экспедиция МОГ Эпсилон-101 («Четыре лампы»). Далее следует протокол экспедиции.