Random Fragments

СССР
Отдел « П»
Главное Разведывательное
Управление
27 января 1991
№11

СЕКРЕТНО

ООЗ «РЕЗОНАНС»

ЛИЧНАЯ КАРТОЧКА

Уровень угрозы: Цхинвал¹

Применимость в хозяйстве: ~~Дигидроген~~² Бутирофенон ³

Подведомственность: Кусачки⁴

Занятная перемена. Из крайности в крайность…

Находится на содержании: Да/~~Нет~~
Искусственное происхождение: Да/~~Нет~~
Применяется в хозяйстве: Да/~~Нет~~
Представляет интерес для конкурентов: Да/Нет

Особые отметки:

ОТСУТСТВУЮТ

Геологический отряд Отдела П ГРУ в пещере [УДАЛЕНО], Грузинская ССР

ХАРАКТЕРИСТИКА

Объект представляет собой скопление аномальных кристаллических структур, занимающих практически всю площадь пещеры [УДАЛЕНО], Грузинская ССР. Условия внутри пещеры и состав пород на данном участке горного массива делают невозможным естественное формирование кристаллов зафиксированного объёма и с обнаруженными особенностями кристаллической структуры (результаты анализа группы геологической разведки Сектора IV представлены в Приложении 4). Предполагается, что данные образования появились в пещере [УДАЛЕНО] в результате неопределённых внешних манипуляций. Попыткой датировки отдельных образцов из кристаллического кластера на данный момент занимается полевая лаборатория геологических исследований, временно располагающаяся на базе Объекта ███, Грузинская АССР. Иных аномальных свойств у кристаллического кластера или отдельных его элементов на данный момент не зафиксировано. Доступ в пещеру [УДАЛЕНО] ограничен под предлогом работы бригады геологической разведки.

М-да уж, какие-то странные горные кристаллы… Можно было выбрать и что-то поинтереснее для последнего получаса своей жизни.

Варианты применения объекта в хозяйстве:

~~ОТСУТСТВУЮТ~~

Обновление от ██.██.1962: в ходе серии тестов на базе полевой лаборатории геологических исследований было установлено, что кристаллы из кластера аномальным образом реагируют на изменения интенсивности онтологического поля.⁵ В случаях, когда объёмная плотность энергии онтологического поля снижается, приборы фиксируют испускаемое кристаллами особое излучение (обозначенное далее как омикрон-волны), в малых количествах не представляющее вреда для человека и слабо взаимодействующее с окружающей материей.

Было установлено, что на изменение онтологического поля одинаково реагирует как весь кристаллический кластер, так и отдельные его фрагменты, находящиеся на значительном расстоянии от области появления. Данное свойство было зафиксировано при проведении вблизи образца кристалла простой парапсихологической⁶ манипуляции. Проведение парапсихологических манипуляций непосредственно возле кластера крайне не рекомендуется в связи с тем, что высвобождаемый объём омикрон-излучения представляет когнитивную угрозу для всех живых существ в радиусе 300 метров от кластера. Дальнейшие опыты разрешено проводить исключительно с отдельными фрагментами кристаллической структуры. УСТАРЕЛО

Варианты применения объекта в хозяйстве:

элемент детектора изменений онтологического поля (портативного или стационарного) – ОДОБРЕНО – при успехе в реализации детекторы на основе фрагментов кристаллического кластера могут облегчить поиск аномальных объектов на большой территории;
—элемент технического устройства для экипировки парапсихологичских отрядов быстрого реагирования, дополнительно усиливающего любую парапсихологическую манипуляцию когнитивным воздействием – ОТКЛОНЕНО – для оказания сколько-нибудь значимого когнитивного воздействия на данный момент необходимо слишком много материала; не найдено способа сфокусировать испускаемое излучение;
обеспечение близлежащих населённых пунктов электроэнергией, создание ловушки для омикрон-излучения и поиск способа конвертации его в электромагнитное – ОТКЛОНЕНО – ресурсозатратная и малополезная манипуляция, ближайшим регионам хватает имеющихся источников энергии.

УСТАРЕЛО

Обновление от 30.12.1991:

ОТСУТСТВУЮТ

ЖУРНАЛ ИССЛЕДОВАНИЙ

██.██.1963: Инициирован проект «Каскад» по разработке экспериментального датчика изменения плотности онтологического поля. Ответственной за разработку назначена рабочая группа 817-1, переведённая из конструкторского бюро экспериментального вспомогательного оборудования Объекта ██.

…

██.██.1964: Получен первый функциональный прототип устройства в рамках проекта «Каскад»; в сопроводительной документации (предоставляется по запросу) обозначен как ДИПОПСЫ-1 (Детектор Изменений Плотности Онтологического Поля Стационарный Ыбышева). Относительно компактное (вес составляет примерно 40 килограмм) устройство способно фиксировать скачки плотности онтологического поля и определять их интенсивность по шкале от 1 до 5. Для развития успеха к проекту привлечено дополнительное финансирование.

Ага, «компактное». Как полная выкладка солдата на марше… Я снова пролистываю несколько строк.

██.██.1965: Четвёртый прототип устройства (ДИПОПСЫ-2М1) за счёт снижения массы до 12 килограмм стал пригодным для ручного ношения. Оперативные группы ████, ████ и ███████ получили образцы устройства для полевого тестирования.

О детекторах я знаю исключительно понаслышке – «в поле» никогда не работал. И тем более не знал, что эти детекторы работают за счёт каких-то кристаллов. Не то что бы мне это вообще было интересно…

██.██.1967: В связи с высокой эффективностью ручных и стационарных детекторов, проектной командой 817-4 под руководством доктора Г.Б. Разумовского выдвинут план развёртывания системы спутников и ретрансляторов на территории стран социалистического блока для раннего обнаружения очагов аномальной активности путём анализа поступающих данных на земных станциях. Реализация инициативы одобрена в рамках проекта «Каскад».

Ты слышишь приглушённый звук пожарной сигнализации со стороны вычислительного центра. Всё идёт по плану. Архив подожжён. Оригиналы документов сгинут в огне.

██.██.1970: Первые 14 спутников, оснащённых доработанными ловушками-поглотителями фонового онтологического излучения и облегчёнными кристаллическими детекторами выведены на орбиту. Запуски замаскированы под создание инфраструктуры для функционирования морской спутниковой навигационной системы «Циклон».

██.██.1970: Сигналы от 12 из 14 спутников успешно приняты системой ретрансляторов в Уральском регионе. Инициирован тестовый анализ онтологического поля в покрываемых спутниками регионах СССР.

…

██.██.1972: Предоставлено разрешение на формирование команды проекта «Столовая гора», предполагающего создание на территории всего социалистического блока и ряда государств–союзников сети ретрансляторов и центров слежения для оперативного наблюдения за изменениями в плотности онтологического поля. В завершённом виде проект должен предоставить возможность осуществлять мониторинг онтологического поля в пределах всего земного шара.

Я смотрю на текст перед глазами чуть яснее. Название проекта кажется знакомым…

██.██.1976: Все учреждения проекта «Столовая гора» начали работу на запланированной мощности. Завершено формирование системы оперативного оповещения об аномальной активности на территории социалистического блока.

Точно. Система оповещения. На большинстве объектов есть специальные наблюдательные центры для приёма сигналов со спутников. Я никогда особенно не интересовался тем, как именно они обнаруживают аномалии. Воспринимал как должное.

██.██.1976: Зафиксированы и в дальнейшем по каналам разведки подтверждены события снижения плотности онтлогического поля на территории КНР, Великобритании, ЮАР, Франции и США. Получено подтверждение эффективности работы проекта «Столовая гора» вне пределов социалистических государств.

…

██.██.1979: Экспериментальным путём с применением более точных измерительных приборов было установлено, что ООЗ «РЕЗОНАНС» испускают постоянное фоновое омикрон-излучение. Указанное излучение становится более интенсивным при воздействии на кристаллы побочного излучения, высвобождаемого при снижении плотности онтологического поля. Эти экспериментальные данные стали опровержением общепринятой теории, предполагавшей, что снижение плотности онтологического поля порождает, а не усиливает испускаемое кристаллами омикрон-излучение. Доктору Г.Б. Разумовскому за сделанное открытие присуждена премия имени М.В. Ломоносова АН СССР.

…

██.██.1981: Доцентом Хаматвалеевым А.И. был предложен способ прогнозирования событий снижения плотности онтологического поля на основе анализа его систематических микроколебаний в локальном масштабе. В дальнейшем эффективность данного метода была подтверждена экспериментально с использованием более чувствительных спутниковых датчиков. Это позволило предсказывать события снижения плотности онтологического поля за несколько часов до непосредственного проявления аномальности. Хаматвалееву А.И. был присуждён Орден Трудового Красного Знамени.

…

██.██.1985: Сформирована команда для осуществления проекта «Длина волны» – анализа показаний детекторов за весь период наблюдения для попытки долгосрочного прогнозирования изменений в онтологическом поле Земли. Куратором проекта назначен доктор Г.Б. Разумовский.

Разумовский, Разумовский… Что-то знакомое. Не у нас работал?

██.██.1985: Доктор Г.Б. Разумовский выступил с докладом «О глобальных изменениях плотности онтологического поля» (Приложение 118). В рамках проекта «Длина волны» создано структурное подразделение, ориентированное на поиск практических методов повышения плотности онтологического поля. Куратором структурного подразделения назначен доктор Г.Б. Разумовский. Привлечено дополнительное финансирование.

Где там этот доклад?..

ПРИЛОЖЕНИЕ 118. Доклад д-ра Г.Б. Разумовского «О глобальных изменениях плотности онтологического поля»

…

…наша команда провела тщательный анализ выходных данных с земных станций системы наблюдения за последние 10 лет, вероятность ошибки сведена к минимуму. На данный момент мы можем сказать, что выводы неутешительные – нестабильность онтологического поля с момента начала анализа постоянно растёт, причём, растёт довольно быстро…

…

…как можно видеть на инфографике, рост разряженности онтологического поля можно представить в виде показательной функции, то есть, общемировая аномальность растёт в геометрической прогрессии. К сожалению, не бесконечно убывающей…

…

…по прогнозам нашей проектной команды, примерно через 80 лет при сохранении фиксируемых темпов роста (за вычетом небольших расхождений) площадь аномального пространства на Земле превысит площадь неаномального…

Я усмехаюсь. Чтение доклада становится всё более интересным.

…как ясно дал понять инцидент на Полигоне 415, устройства под индексом СОПЛО-64 не могут быть признаны достаточно надёжными для обеспечения стабильности онтологического поля в долгосрочной перспективе…

СОПЛО, СОПЛО… Никакие колокольчики в голове не отзываются.

…в связи с указанными факторами считаю крайне важным начать разработку новых методик воздействия на онтологическое поле уже сейчас. Проект «Длина волны» должен быть переиориентирован и обеспечен дополнительным инженерно-техническим персоналом и финансированием…

Я с интересом возвращаюсь к журналу исследований, надеясь на худшее.

██.██.1986: Доктором А.И. Хаматвалеевым предложена компьютерная модель, на основе данных с земных станций способная предсказывать локальные снижения плотности онтологического поля по зафиксированным микроскачкам примерно за сутки до фактических проявлений аномальности. Модель получила кодовое обозначение «Лямбда» и была интегрирована в систему оперативного оповещения об аномальной активности. Доктору А.И. Хаматвалееву присуждена премия имени П.Л. Чебышева АН СССР.

За спиной слышится приглушённый взрыв. Помещение ощутимо трясёт, скрипит неподалёку серверный шкаф. Дверь в вычислительный центр – всё. Оглядываюсьна строку состояния. 68 процентов. Должен успеть… Вторую дверь вряд ли будут так же взрывать. За сервера побоятся. Собственная осторожность их и погубит…

██.██.1987: Доктором А.И. Хаматвалеевым представлена доработанная версия предыдущей компьютерной модели, получившая обозначение «Лямбда-2». За счёт изменения подхода к анализу данных и включения в модель новых переменных, стало возможным прогнозировать общее состояние онтологического поля на планетарном масштабе в долгосрочной перспективе. Из-за специфики интерпретации данных «Лямбда-2» имеет крайне низкую прогностическую эффективность при моделировании аномальных событий локального масштаба.

Раньше я всегда радовался успехам советской науки и своих коллег… Но не в этот раз.

██.██.1987: Доктор А.И. Хаматвалеев выступил с докладом по результатам анализа двадцати симуляций «Лямбда-2» длительностью от 30 до 50 лет (Приложение 144). Им выдвинута теория об экспоненциальном истончении онтологического поля Земли и предложен план по реструктуризации проекта «Длина волны».

Улыбка становится шире. Я открываю первое приложение.

ПРИЛОЖЕНИЕ 144. Фрагмент доклада доктора А.И. Хаматвалеева на совещании рабочей группы 817-1

…

…«небольшие расхождения» в расчётах, которые при составлении инфографики два года назад сгладили, не являются «расхожденими», они идеально согласуются с показаниями моей компьютерной модели и подтверждают то, что разряженность онтологического поля растёт как экспонента, а не как показательная функция…

Я улыбаюсь всё шире.

…если провести расчёты с данными поправками, до момента, когда неаномального пространства станет меньше, чем аномального, пройдёт практически на две трети меньше времени…

…

…по данным компьютерной модели, спустя 40 лет на планете Земля останется всего четыре неаномальных территории: Шпицберген, юг Великобритании, штат Массачусетс и Адыгейская автономная область…

Я откидываюсь на стуле, смеясь уже во весь голос. За спиной слышится шипение газового резака.

…инцидент на Полигоне 415 — явное следствие внешнего вмешательства в работу стабилизирующего контура, не существует иных прецедентов, которыми можно было бы подтвердить ненадёжность серийных версий прибора СОПЛО-64. На данный момент это единственная эффективная технология, которая в долгосрочной перспективе смогла бы выравнять онтологическое поле…

Нет-нет-нет… Тем лучше, что её уже начали выводить из эксплуатации…

…также я хотел бы обратить внимание на… Весьма тревожащие показания приборов. Если судить по этой диаграмме, с момента активного освоения кристаллических структур ООЗ «РЕЗОНАНС» мы наблюдаем дополнительное ускорение роста разряженности онтологического поля, как будто на него оказывается внешнее воздействие…

Я снова хмыкаю.

…пока ситуация не стала критической, необходимо бросить все силы на доработку устройств проекта «Якорь», финансирование, выделенное на «Длину волны», также должно быть перенаправлено. Ключевая задача — найти способ увеличить радиус действия установок СОПЛО-64 и отойти от контурного варианта их размещения…

Да, да, конечно…

…проблема скачкообразного падения плотности онтологического поля — общемировая, она требует для решения беспрецедентного количества ресурсов и квалифицированного персонала. Имеет смысл связаться с организациями по надзору за аномалиями из капиталистических стран, организовать совместные проектные команды исследователей онтологического поля…

Какая жалость… Какая жалость, что у вас больше нет ни ресурсов, ни квалифицированного персонала…

Предложения не поддержаны остальной рабочей группой и куратором проекта, доктором Г.Б. Разумовским ввиду личной заинтересованности доктора А.И. Хаматвалеева в проекте «Лямбда-2» и факту участия в разработке устройств СОПЛО-64. Экспериментальная проверка теории экспоненциального роста разряженности онтологического поля внесена в список задач проекта «Длина волны» с присвоением низкого приоритета. (Приложение 145)

Мои губы снова растягиваются в улыбке. Шум газовых горелок становится громче. Я закрываю приложение и возвращаюсь к журналу исследований. Я абсолютно спокоен. Мне весело.

██.██.1987: Начата перепроверка показаний компьютерной модели «Лямбда-2» под руководством ведущего исследователя Е.Г. Разумовского. Интеграция модели в систему оперативного оповещения об аномальной активности временно приостановлена.

██.██.1987: Ведущим исследователем Е.Г. Разумовским созвано экстренное совещание рабочей группы для представления промежуточных результатов проверки показаний измерительных приборов системы оповещения. В рамках совещания выдвинута гипотеза, предполагающая, что омикрон-волны, порождаемые кристаллами ООЗ «РЕЗОНАНС», являются не следствием, а причиной усиления аномальности в области излучения. Начаты мероприятия по экспериментальной проверке указанной гипотезы.

Я облизываю губы. Словно в предвкушении.

██.██.1988: Доктор А.И. Хаматвалеев и ведущий исследователь Е.Г. Разумовский в ходе серии экспериментов получили первые подтверждения гипотезы о влиянии омикрон-волн на окружающее онтологическое поле.

Это ваша плата за всю ту гниль, которую породил мир победившего капитализма. Все будут умирать в мучениях. Один за другим.

██.██.1989: Приостановлено всеобщее внедрение системы раннего оповещения об аномальной активности на территории объектов Отдела. Рабочая группа в экстренном порядке переориентирована на повторное проведение экспериментов, направленных на уточнение влияния омикрон-волн на окружающее онтологическое поле.

Поздно. Я смеюсь. Уже слишком поздно.

██.██.1990: Службой контрразведки зафиксирована и предотвращена попытка бывшего участника проекта «Длина волны» доктора А.И. Хаматвалеева выйти на связь с информатором из организации-конкурента (текущая версия — Фонда SCP). Указанный сотрудник помещён под стражу по обвинению по статье 64 УК РСФСР. ~~Заседание службы внутреннего трибунала назначено на ██.██.1990.~~ ~~Перенесено на ██.██.1990.~~ Перенесено на ██.██.1991.

Продажный ублюдок. Ничего страшного. Контрразведка почти вся наша. Скорее всего, ты уже сдох в канаве, как собака.

██.██.1990: Установлено, что пагубное воздействие на онтологическое поле оказывают исключительно кристаллические структуры, отделённые от основного кластера. В рамках специального доклада доктор Е.Г. Разумовский представил результаты перепроверки показаний компьютерной модели «Лямбда-2»; была подтверждена её предсказательная точность.

Теперь я вспомнил, где видел фамилию Разумовского. В расстрельном списке. Он с частью команды отказался защищать наш объект и пытался остановить зачистку базы данных. Ещё одна помойная крыса…

Журнал не закончен. В нём стоит ещё одна дата, за 1991 год, но к ней нет никаких комментариев, только указание на ещё одно, последнее приложение. Видно, что документ дополняли в спешке. Приложение даже не озаглавлено. Я открываю его.

Это текст электронного письма с приказом, подписанным лично директором Отдела. Немедленно вывести из эксплуатации всё оборудование и приборы, содержащие в своей конструкции кристаллические структуры ООЗ «РЕЗОНАНС». Я оглядываю приложение. Нет, это не письмо. Это шаблон письма. Оно так и не было разослано – Разумовского с рабочей группой расстреляли раньше.

Я снова смеюсь. Ну что же… Теперь оно никогда и не будет разослано.

Звуки горелок становятся всё громче. Я оборачиваюсь. В массивной двери практически сформировался контур отверстия, через которое согнувшись мог бы пройти человек. Ещё несколько минут и всё будет готово.

Я смотрю на монитор командного терминала. Ошибка. Один файл не может быть удалён, так как в данный момент используется.

Я выключаю рабочий компьютер. Последний документ, главная тайна. Удаляю его вручную. Теперь список файлов пуст. Я успел.

Возможность предсказать появление аномалий — это ведь так полезно. Так важно. Ни у кого другого не было столь же «надёжной» системы мониторинга и прогнозирования, как у Отдела «П». Детекторы нужны всем. А с системами оповещения помогут разобраться постсоветские манкурты.

Чтобы чем-то пользоваться, совсем не обязательно знать, как именно оно работает, правда?

Вы будете думать, что нашли золотую жилу. Что теперь содержать аномалии станет проще. И сами пройдёте точку невозврата. Уничтожите свой драгоценный мир рынка и «свободы» собственными руками. Это ли не вселенская справедливость? Вселенская справедливость, которая свершится благодаря мне.

Горелки уже смолкли. Осталось лишь заложить на дверь заряд. Не очень мощный – чтобы не повредить в серверной ничего лишнего.

Я смеюсь. Уже слишком поздно. Дело сделано. Осталось лишь подготовиться к встрече…

Сноски

5. Интенсивность онтологического поля по классификации Отдела «П» ГРУ синонимична стабильности ткани реальности. Чем менее плотно онтологическое поле – тем больше риск проявления в области «истончения» аномальной активности. Верно и обратное — если в зону с плотным онтологическим полем внести аномальный объект, оно естественным образом начнёт истончаться.

Фрагмент списка для редактирования

Содержание
4000-4099
4100-4199
4200-4299
4300-4399
4400-4499
4500-4599
4600-4699
4700-4799
4800-4899
4900-4999

4000-4099

SCP-4004 - A Dream Come True
SCP-4005 - The Holy and Heavenly City of Fabled China
SCP-4009 - Big Brozart is Watching You
SCP-4013 - It Can't Be Allowed To Stop
SCP-4015 - The Keepers
SCP-4016 - Of Mice and Twine
SCP-4018 - Eye
SCP-4020 - It Won't Stop Screaming
SCP-4021 - Mandarin Oranges
SCP-4023 - The Inexplainable Nature of Twenty Three
SCP-4025 - Blutfahne
SCP-4027 - Anomalous Dissociative Identity
SCP-4029 - Too Many Legs to be Going Nowhere
SCP-4030 - It Wants to be Free
SCP-4032 - Deadly Fart Berries
SCP-4034 - Defenetre of the Strate
SCP-4035 - Prey on Words
SCP-4036 - The Republic
SCP-4037 - One of Mind
SCP-4038 - The Common Tongue
SCP-4039 - The Second Second Law of Thermodynamics
SCP-4041 - Impostors of the Tyrant Lizard King
SCP-4042 - Somebody to Love
SCP-4043 - Gaia
SCP-4044 - A Reprieve
SCP-4047 - Abstract Art
SCP-4048 - We need to talk about your forklift certification
SCP-4049 - Beast Pits
SCP-4051 - Your Friendly Neighborhood Keter
SCP-4052 - Sandwich (disambiguation)
SCP-4053 - The Gift of Life
SCP-4055 - Three Split Seconds
SCP-4056 - Nuclear Family Unit
SCP-4058 - We Become Stories That Are Dying To Be Told
SCP-4059 - The Jersey Devil
SCP-4061 - Unphotographable
SCP-4063 - What Remains
SCP-4064 - "It's not you, it's us"
SCP-4066 - The Byzantine Empire Was Secretly Aliens
SCP-4067 - Effigies From The Swarm
SCP-4068 - Buzzword
SCP-4069 - Out of Range
SCP-4071 - History Rewritten
SCP-4073_$N$ - Just Blowing Hot Air
SCP-4074 - Sun Flower
SCP-4075 - Birds of a Feather
SCP-4076 - Video Hurt System
SCP-4077 - City of Gold
SCP-4078 - Neo-Lamarckian Genetic Engineering
SCP-4079 - Saving Archimedes
SCP-4081 - Audition Interference
SCP-4082 - NeoVancouver Free Radio
SCP-4083 - Lakeside View Apartments
SCP-4084 - Then Who Was Phone?
SCP-4085 - What business, nay?
SCP-4086 - The Tunnels
SCP-4090 - The Dream of the Anartist's Son
SCP-4091 - A Boy's Dog
SCP-4092 - Rubber Stepdad
SCP-4094 - They Hunger Beneath the Ice
SCP-4097 - Louder Than God's Revolver And Twice As Anomalous

4100-4199

SCP-4101 - The World's Greatest Teacher is History
SCP-4102 - I Have a Bridge to Sell You
SCP-4103 - Holiday in Hell
SCP-4104 - He’s lying to you all.
SCP-4105 - They Came From the River
SCP-4106 - The Love Bird
SCP-4108 - Not Really a Catapult
SCP-4109 - FINAL CONCLUSION: EVERYTHING IS TERRIBLE
SCP-4110 - The Ultimate Cosplay
SCP-4111 - Straight From the Horse's Mouth, and Into the Fire
SCP-4112 - We Have Assumed Control
SCP-4113 - Long is the Way You Must Wander
SCP-4114 - Occult Escapologist
SCP-4115 - Beast of the Crystal Caves
SCP-4116 - The Nightmare King in The Palace of Dreams
SCP-4117 - Mannequins of a Table
SCP-4118 - Tube O' Dinos
SCP-4119 - Miss Dynamite
SCP-4121 - The Loop That Never Breaks/Never Has/Never Will Be Broken
SCP-4122 - The Second-long Pipe
SCP-4123 - Gamemaster
SCP-4124 - Friendship is fleeting, Trauma is forever.
SCP-4125 - Revenimus
SCP-4126 - The Bedsheet Ghost
SCP-4128 - Action Comics #1
SCP-4129 - For Here or To-Go?
SCP-4130 - Su Alteza Serenísima
SCP-4131 - Gunhead Anomalocaris, Trilobite Slayer!
SCP-4132 - Retrochronal Observation Tank
SCP-4133 - The Pinup That Doesn't Exist
SCP-4134 - Claymore Anti-Personnel Mimes
SCP-4137 - Hyper-Axial Nintendocore Overdose
SCP-4138 - To the Stars
SCP-4139 - Fridge Backpack
SCP-4140 - Sarkic Containment Procedures
SCP-4141 - "You: The Real-Time Autobiography"
SCP-4143 - Infinitestine
SCP-4144 - The Most Important Meal Of The Day
SCP-4145 - Dissociative Dream Therapy™
SCP-4147 - Encyclopedia Obscura
SCP-4149 - Professor Xorkanoff's Gallery of the Bizz-art
SCP-4150 - Beatlemania!
SCP-4151 - The Garden of Gluttony
SCP-4152 - BASEMENT LOVE, Acrylic on canvas
SCP-4153 - Vincent Price presents… IT CAME FROM SITE-9!
SCP-4154 - Petwyrm
SCP-4155 - Soft Serve Kittens
SCP-4159 - Oh God Something Touched My Leg
SCP-4160 - Those Who Don't Learn From History
SCP-4161 - METEMPSYCHOSIS.
SCP-4162 - An Egg That Kills You For No Reason
SCP-4163 - The Tetris Prodigy
SCP-4164 - The Universal Instruction Manual
SCP-4167 - Heterophyes neurensis
SCP-4168 - Decomposing Love
SCP-4169 - Carbonized Purgatory
SCP-4170 - The Dark
SCP-4172 - The Artist
SCP-4173 - The House on Hadley Hill
SCP-4174 - Mother of Many
SCP-4175 - Friends Made, and the Void
SCP-4178 - Arachnespheksophobia
SCP-4179 - Milestones
SCP-4180 - Tomorrowland
SCP-4181 - Spatuland
SCP-4184 - Threnody, Requiem, Dirge
SCP-4185 - we outrun yourself
SCP-4186 - Postcards From Italy
SCP-4187 - Bu(r)g(er) King
SCP-4188 - What Dreams May Come
SCP-4189 - Vengeful Assimilation Coral
SCP-4191 - Draco ignem
SCP-4196 - Daughter of the Confederacy
SCP-4197 - Hollow
SCP-4198 - Feed Your Hair
SCP-4199 - An Average Joe

4200-4299

SCP-4200 - The World, Idealized
SCP-4202 - The Sleepy Clapper
SCP-4203 - Sometimes a Damselfly Just Wants Some Dick
SCP-4204 - To Pluck the Moon From the Sky
SCP-4207 - Auditory Entity
SCP-4208 - Naomi’s Sweetery
SCP-4209 - Egg-Cellent Boys!
SCP-4210 - The American Dream
SCP-4211 - Memoirmento
SCP-4212 - A Very Helpful and Clearly-Written SCP Report
SCP-4214 - commission request for advertisement of product (c.r.a.p.)
SCP-4215 - The Inkredible 51st Squiddy Squaddy
SCP-4219 - LUDROA
SCP-4221 - What A Wonderful World
SCP-4222 - International Monetary Fish
SCP-4223 - The Baja Blast^TM
SCP-4224 - History Will Be Kind To Me
SCP-4226 - The Spring of the Ages
SCP-4227 - Where lost things go…
SCP-4229 - Mother's Gift
SCP-4230 - The Redacted Fanon wiki
SCP-4231 - The Montauk House
SCP-4232 - Thought Crustacean
SCP-4233 - The Dreadnought
SCP-4234 - Testicles, and the Sudden Lack Thereof
SCP-4235 - Rosa aeternum
SCP-4236 - It's the End of the World (And Everyone Feels Fine)
SCP-4237 - Where Winter Rests
SCP-ℸp♡9 - or, KTE-6561-Black, or, dolphinslugchugger and scarhaver's GAW-1 proposal, or, 8008132, or, Our Friend Who Lives By The Lake, or, The Lake, or, A Very Important Question, or, The Reason We Did Something New This Time, or, Go Big or Go Home
SCP-4242 - Foundations
SCP-4243 - Celltown
SCP-4244 - Good Taste In Musicians
SCP-4245 - BellyFlopology
SCP-4246 - Thalassomania, or The Dreams of the Firstborn
SCP-4248 - Alphabet and Omega
SCP-4249 - Nothing Really Mattress Anymore, or: Zen And The Art of Hunting Free-Range Furniture
SCP-4250 - Colorful Pens With Thematic Ends
SCP-4252 - Beans and Betrayal
SCP-4253 - The Drowned
SCP-4254 - Elvis?
SCP-4255 - Santa Claus, The Time Traveler
SCP-4256 - Bootlegger's Press
SCP-4258 - Freddy's Diner
SCP-4260 - The Subdirective
SCP-4261 - In Case of Emergency, Blow Shofar
SCP-4262 - The Essential Thing Is Not To Have Conquered But To Have Fought Well
SCP-4263 - Gemini
SCP-4265 - Filmographer Snake
SCP-4266 - The Thing That Makes You Kill People
SCP-4267 - Down With The Flue
SCP-4268 - Eviction
SCP-4269 - Fuck With The Lights Turned-On
SCP-4270 - Does Benjamin Harrison Shit In The Oval Office?
SCP-4271 - Silicon Valley
SCP-4272 - The Proper Way to Appreciate Art
SCP-4273 - Designated Successor
SCP-4275 - The Old Man of the Sea
SCP-4276 - Dance Till You're Dead
SCP-4277 - Bullet Farm
SCP-4278 - The Island at the End
SCP-4279 - A Toast to my Finished Thesis
SCP-4280 - The Inter-Dimensional Insult Punishment Jar™
SCP-4281 - Stalled Conversation
SCP-4282 - Mutiny's Bane
SCP-4283 - Heart of Ouachita
SCP-4284 - Walker Towers
SCP-4285 - Dank Memetics
SCP-4287 - P. Pigeon, Esq.
SCP-4289 - The Bunyip
SCP-4291 - The Little Death
SCP-4292 - "herbie fucker really very good circus of the unsettle by dado"
SCP-4293 - In One Man’s Honour, A Dossier Of unBÄRable Solitude
SCP-4294 - In the Cold Shadow of her Ovary Tower
SCP-4295 - A Homebody
SCP-4297 - The Emu-lution of War
SCP-4298 - Cell Door #546 or Site-446's Paradox
SCP-4299 - I See Life in Rosy Hues

4300-4399

SCP-4300 - To Lose One's Soul
SCP-4301 - Timothy Gilles
SCP-4302 - Prior Predator
SCP-4303 - Wild Rose
SCP-4304 - There Is No Honor Among Thieves (Even When Mechas Are Involved)
SCP-4305 - No Lifeguard On Duty
SCP-4306 - Stan the Janitor
SCP-4307 - Electro-Marine Praetorian
SCP-4308 - Heartfelt
SCP-4309 - Huddle with Us
SCP-4312 - Drift Into the Sky
SCP-4315 - S.C.P. Lovecraft
SCP-4317 - Catscratch
SCP-4318 - A HORRIFIC, DEADLY, EVIL Chemical [BEWARE]
SCP-4320 - Show Me The Glint of Light on Broken Glass
SCP-4321 - Sometimes I Look At The Sky So I Can Feel Small
SCP-4323 - Touch
SCP-4324 - Saint Torben the Strange
SCP-4325 - NO SIGNAL
SCP-4326 - Honeymooners
SCP-4327 - Suppressive fire in, suppressive fire out! Do the hokey-pokey and that's what it's all about!
SCP-4328 - Sinew and Cellulose
SCP-4329 - [ACCESS DENIED]
SCP-4331 - When Good Elk Go to War
SCP-4333 - The Profligate
SCP-4338 - Vulcan, the Disaster
SCP-4341 - Unimal Life
SCP-4343 - You Will Be Free
SCP-4345 - Not your Home, not your Pain, not your Self.
SCP-4346 - Searching for Friends in a Room Full of Loneliness
SCP-4347 - Goat of Departure
SCP-4349 - …But I Play One On TV
SCP-4350 - I See Yellow People
SCP-4351 - Home
SCP-4353 - Your 223rd First Day
SCP-4354 - From The Ink Under Your Skin To Flesh
SCP-4355 - OZYMANDIAS, KING OF KINGS
SCP-4356 - The Not-Quite-Broken-Clock Affair
SCP-4357 - Slimelord
SCP-4358 - An Undying Love
SCP-4359 - Sash Lantern
SCP-4361 - Red is Her Favorite Color
SCP-4362 - Achilles Defense Systems
SCP-4363 - Wake Me Up, I'm Living a Nightmare
SCP-4365 - Five-Story Upside-Down Hotel
SCP-4366 - Invisi-Birds
SCP-4367 - What Are The Odds?
SCP-4368 - To Sleep, Perchance to See
SCP-4369 - Cassandra: Play Your Part
SCP-4370 - POST-INDUSTRIAL
SCP-4371 - Lee and Skorzeny, in the Apennines
SCP-4372 - So Very Small, So Very Safe
SCP-4373 - Drown
SCP-4374 - This Is You
SCP-4375 - Two Forgetful Men
SCP-4376 - Have you tried just smiling more?
SCP-4377 - Fight! Fight for the Man of the People!
SCP-4378 - Her Noodly Appendage
SCP-4379 - New Sun Will Rise, and Shadows Quickly Fade
SCP-001 - First and Foremost
SCP-4381 - Moccus Meme
SCP-4382 - Entropic of Hulwick
SCP-4383 - Sticks and Stones, Blood for Old Bones, a Curse Forever Thirsty.
SCP-4385 - Dimensional Phone Line
SCP-4386 - B Gone, B
SCP-4387 - Don´t lose your head, comrade
SCP-4388 - Rampant OSHA violations
SCP-4389 - Big Ol' Eyebrows
SCP-4390 - A Bad Maze
SCP-4392 - Sandpit
SCP-4393 - The Beating Sounds of a Thousand Paper Wings
SCP-4394 - Liquid Piano
SCP-4395 - That Contagious Thing
SCP-4396 - The Joy of Completion
SCP-4397 - Medila's Altar
SCP-4398 - Distant Triangles of Energy

4400-4499

SCP-4400 - This Is Not A Place of Honor
SCP-4401 - Total Eclipse Of The Heart
SCP-4402 - The Permanent Shopping List
SCP-4403 - The Silent Crusade
SCP-4404 - The Scent of Silence
SCP-4406 - SUDDEN THUNDER
SCP-4407 - "TelaV, the Punishing Demon"
SCP-4408 - It's not the Foundation that he's afraid of.
SCP-4409 - The Elephant Man
SCP-4410 - The Ongoing Development of an Art Form
SCP-4411 - At Long Last Landing
SCP-4412 - What Could Have Been?
SCP-4413 - The End of Something Really Excellent
SCP-4414 - "PEEL"
SCP-4415 - Humanoid Containment Chamber #λ045
SCP-4416 - Tails of Site-42: Why The Foundation Punches Sharks
SCP-4417 - The Long Way Round
SCP-4418 - The Lovers
SCP-4419 - The Butcher's Chariot
SCP-4421 - Papa Legba's Walkin' Stick
SCP-4422 - O Tempestas, O Mores
SCP-4423 - StepDemon
SCP-4424 - The Train With No Final Station
SCP-4425 - Chef Arkady's Canned Surprise!
SCP-4426 - The Unforgettable Fire
SCP-4427 - Nobody Stands for the People
SCP-4429 - William Shatner's Cover of "Common People"
SCP-4431 - Bleeding Beneath Antarctica
SCP-4433 - Suburban Nightmare
SCP-4434 - Anglerfish
SCP-4435 - Sins of the Father
SCP-4436 - Jesus Saves
SCP-4437 - NANI?! MULTI TIMELINE DRIFTING?!?
SCP-4438 - FOURTH
SCP-4439 - The Weeping Child
SCP-4440 - IT'S NERF OR (___)
SCP-4441 - Summer Scare
SCP-4442 - How's My Driving?
SCP-4444 - Bush v. Gore
SCP-4445 - The Day the Music Died
SCP-4447 - Sasha's Super Shuttle Service!
SCP-4448 - The Elk in the Lake
SCP-4452 - Submitted to the Ethics Committee for review
SCP-4453 - Wholesome Family Goddess
SCP-4454 - Looking For Someone To See The World With
SCP-4455 - In Short…
SCP-4457 - Assopods
SCP-4458 - jaws is gonna get ya
SCP-4460 - Humorous Factory
SCP-4461 - lonely at the bottom, innit
SCP-4462 - Fan Death
SCP-4463 - Ecosystem Restore Point
SCP-4466 - Why the Long Face?
SCP-4468 - Take-a-Wish
SCP-4469 - Memory Shovel
SCP-4470 - Endure
SCP-4471 - Hoard
SCP-4472 - Auger
SCP-4475 - So Long, and Thanks for All the Milk
SCP-4476 - La Famille Natau
SCP-4477 - Leave Room for Jesus!
SCP-4479 - D-11424 and The Land of Too Many Doors
SCP-4480 - The Snake Doctor
SCP-4481 - A Casualty of the Single Worst Astronautical Disaster in History
SCP-4482 - Last Call
SCP-4483 - Cut off the Head
SCP-4484 - StreamSavers
SCP-4485 - Такой чёрный свет (статья ранее была переведена, старый текст находится ссылке, статья была плохо реализована технически и удалена)
SCP-4486 - Happy Is Relative
SCP-4487 - The Sermon Will Continue
SCP-4489 - Apologies
SCP-4490 - Cruel To Be Kind
SCP-4491 - "pulp ficktion"
SCP-4492 - Umbrella In The Toilet
SCP-4493 - Keep Pride Out of Corps
SCP-4495 - A God for Pigs
SCP-4496 - Gold Plastic Syndrome (Infectious)
SCP-4497 - Whose Cuisine Reigns Supreme?!
SCP-4498 - The Plurality of Jack Bright
SCP-4499 - YES, ONLY $44.99!

4500-4599

SCP-4501 - At The Mountains Of Minty Freshness
SCP-4502 - Emily The Eldritch Ergot Goddess & Friends
SCP-4504 - The Handless Man
SCP-4505 - A Brief History of Anomalous Artwork in the Renaissance
SCP-4506 - Eternal Child Star
SCP-4507 - The Solitary Path to Enlightenment
SCP-4509 - Lovers' Lane
SCP-4510 - Avelar Express First Class Prime™!
SCP-4512 - A Goddamn Filthy Teleporting Party Pool
SCP-4513 - Pounded in the Butt with Moby Dick by my IRS W-2 Tax Form
SCP-4515 - Why is the Sky?
SCP-4516 - Don't fuck with hyper-religious cats
SCP-4518 - MBMBMBMBMBMBMBaM
SCP-4519 - Carl Sagan, Godhead
SCP-4520 - Alea Iacta Est
SCP-4522 - The Mystical Village of the Jade Peach
SCP-4523 - Cave Story
SCP-4524 - A Flesh, New World
SCP-4526 - I'm Her Union Rep, Jimmy No-Last-Name
SCP-4527 - Crippling Indecision
SCP-4528 - Accendium Lucia
SCP-4529 - A Walk in the Park
SCP-4530 - And Into The Woods We Go
SCP-4531 - Silence encourages the tormentor, never the tormented.
SCP-4532 - Wire Transfer
SCP-4533 - Terms and Conditions Apply
SCP-4535 - The Better Man
SCP-4536 - The Great American Pyramid
SCP-4537 - Artist's Syndrome
SCP-4538 - Flash! Bam! Alakazam!
SCP-4539 - The Worst Calculator Ever
SCP-4540 - History, Together
SCP-4541 - A Toy Story
SCP-4542 - Bug Bunnies
SCP-4543 - Dead Men Sell No Sales
SCP-4544 - The Circumventing Shoe Box
SCP-4549 - Retrohippies
SCP-4550 - An Operational Foundation Site
SCP-4551 - Bell for a Funeral…
SCP-4552 - Auguries of Innocence
SCP-4553 - Bob Shepherd, Anthropomorphic Mass of Worms and United States Representative of the 3rd Congressional District of Nebraska
SCP-4554 - Liquid Sunshine
SCP-4556 - Belonging
SCP-4557 - Detective Fiver, Crime Solving Raccoons
SCP-4560 - Everything is Fine
SCP-4562 - Melody of your life
SCP-4563 - Doctor Barnabas P. Lockwood, MD.
SCP-4564 - Butthole Surfers
SCP-4566 - The Mark of Xerrox
SCP-4567 - Biological Oil Platforms
SCP-4569 - Plot Twist
SCP-4570 - Almost Heaven, West Virginia
SCP-4571 - Curious Creature of the Cold Red Desert
SCP-4572 - Trumpvoid
SCP-4573 - ULTRA TASTE
SCP-4574 - Paleolithic Spear Tigers
SCP-4575 - Seemingly Unconnected Events
SCP-4576 - Protective Prickly Pal, Prixors
SCP-4577 - When I'm dead, just throw me in the trash
SCP-4579 - Quack-stral Projection
SCP-4580 - The Seekers of Secrets
SCP-4581 - Anti-Racist Audiocassette
SCP-4582 - New (New York, New York) York
SCP-4584 - cold dreams.
SCP-4585 - Literally a Hamburger
SCP-4586 - The Well-Mannered Victorian Skeleton
SCP-4588 - The Sentient Scraps
SCP-4589 - Unitea
SCP-4590 - The Manicheans Have the Paintings
SCP-4591 - Twenty Text Messages
SCP-4592 - There is Music in the Void
SCP-4593 - Clevair
SCP-4594 - There's a gullet beneath London
SCP-4596 - A Farm Upstate
SCP-4597 - Thick-Skinned Man
SCP-4598 - The Spiral Gestalt

4600-4699

SCP-4600 - Debt
SCP-4601 - Revenge Of The Redd Mennace!
SCP-4602 - The Money-ki Neko
SCP-4603 - The Ballad of Frank and Mia; Written and Composed in B-Major
SCP-4604 - Disillusionment
SCP-4605 - E.T. the Earthen Totality
SCP-4606 - "Deimos"
SCP-4607 - Whalefall City
SCP-4608 - Appleseed
SCP-4612 - Not All Gods Decompose
SCP-4613 - Edward James Almost
SCP-4615 - Supper Memories '06
SCP-4616 - It Haunts The Fields
SCP-4617 - Selfish Preservation
SCP-4618 - Anomalous Carpool
SCP-4619 - reflect.mp4
SCP-4620 - Bread for Today, Wage for Never
SCP-4621 - An Eternal Fiery Nightmare
SCP-4622 - Requiem
SCP-4623 - The Bard (Owl) of England
SCP-4624 - Mandatory Fun
SCP-4625 - Oizys' Hope
SCP-4626 - The only thing we have to fear…
SCP-4627 - Familiar, yet different
SCP-4628 - Pie is Wrong
SCP-4630 - I Put My Lettuce in the CRISPR and Now It's Sapient
SCP-4631 - Never a Devil Again
SCP-4632 - Would you know if you were dreaming right now?
SCP-4635 - English is the language of the demon.
SCP-4637 - Resource Allocation
SCP-4638 - It’s Only Spinach, Really
SCP-4639 - Product Profile - Citrus Vitae
SCP-4640 - Let the darn kid experience real life!
SCP-4641 - Get a Clue
SCP-4642 - Self-portrait
SCP-4643 - The Wheel of Fire
SCP-4644 - Sea, Sky, and Spirit
SCP-4645 - Blackmailing Computer
SCP-4646 - Sing Me a Song for the End of the World
SCP-4648 - Regaining Focus
SCP-4649 - BLOOD FOR THE BLOOD GOD
SCP-4650 - A Modern Problem
SCP-4651 - The Rat Race
SCP-4652 - Moonbeam Moonshine
SCP-4653 - Ambrosial Insects and Starving Gods
SCP-4655 - Comfort Comes In Many Different Forms
SCP-4656 - Significant Figures
SCP-4657 - Fireworks For a Friend
SCP-4658 - Control Kink
SCP-4659 - Close Encounters of the Sardonic Kind
SCP-4660 - The Cat Came Back
SCP-4662 - Billy's Already Home
SCP-4663 - 3D Printed Spiders Printing Printed Printers Printing Spider Printers Printing Spiders Printing Printed Spider Printers Printing Printing Spider Printers Printing Spiders Printing Printed Printer Spiders Printing Spidered Spider Printers Printing Spider Spider Printered Printer Printers
SCP-4664 - Nightmare of 20,000 Feet
SCP-4665 - The Caprine Conspiracy
SCP-4667 - I Am Become Teeth
SCP-4668 - Since I Left Me
SCP-4669 - Nuestra Señora de la Revolución Popular
SCP-4671 - Clarky the Clown
SCP-4672 - Meteoric Dog
SCP-4673 - Reverse Identity Theft
SCP-4674 - Eternal Beauty
SCP-4675 - I Don't Exist
SCP-4676 - The Consequence of Unwanted Isolation or Gratuitous Seclusion
SCP-4677 - Coke, Cow, and Capitalism
SCP-4678 - A Time and Place for Regret
SCP-4679 - The Sweet Taste of Victory
SCP-4681 - Donec mors nos separaverit
SCP-4682 - Body Dysmorphia Mirror
SCP-4863 - Apples of Discord
SCP-4864 - Wizard Cops
SCP-4685 - Every Man Must Pay His Due
SCP-4687 - the call of the void
SCP-4688 - Manipulative Bike Helmets
SCP-4690 - Lieutenant Pinkerton Eaten Alive by Fucking Spiders
SCP-4691 - Locked In
SCP-4692 - The Curious Case of Jackson W. Parnell
SCP-4693 - !!WATCH FLIPPIN' FIT FOREIGN CHICKS ENTERTAIN YOU LIVE!!
SCP-4694 - PryMaid
SCP-4695 - Synesthesia Inducer
SCP-4696 - GRONK WANT GUTS! GRONK WANT GUTS
SCP-4697 - Dropping Off The Kids
SCP-4698 - Heir To Cernunnos
SCP-4699 - and only the doorway remains.

4700-4799

SCP-4700 - Orkney Rising
SCP-4701 - Well, Yeet Me Mama Like A Wagon Wheel
SCP-4702 - Gehenna, Unknown to Man
SCP-4704 - You've Got Maeril
SCP-4705 - The Hell We Bring With
SCP-4706 - An Array of Nonsense
SCP-4707 - R.E.A.D.
SCP-4708 - Thpecial Containment Prothedure
SCP-4709 - At The Risk Of Sounding Repetitive
SCP-4710 - Sheen Gojira
SCP-4711 - The Inconvenience Store
SCP-4712 - A Failure of Purpose
SCP-4713 - "Astromoles"
SCP-4714 - My Unicorn Friend
SCP-4715 - A Demon Born of War
SCP-4716 - The Plutovore's Cookbook
SCP-4717 - Let It R.I.P
SCP-4718 - Unsinkable
SCP-4719 - Cat-train
SCP-4720 - So Come on ye Childhood Heroes! Won’t You Rise Up From the Pages?
SCP-4721 - Euclid
SCP-4722 - Paths to Fulfillment
SCP-4723 - Reservoir Cats
SCP-4724 - Making a New Life
SCP-4728 - Deletion
SCP-4730 - Reinventive Design for Abnormally Dense Cars
SCP-4731 - Sublunary Skybox
SCP-4732 - "Frank Sinatra and Dean Martin: Our Kind of Paradise!"
SCP-4733 - But Not Forgotten
SCP-4734 - The K-T Extinction Bootstrap
SCP-4735 - You're alight again, my dear.
DEAD WEIGHT ≡ DON'T KILL THE VIBE
SCP-4737 - Fancy
SCP-4738 - An Innocent Sin
SCP-4739 - It's Just Spoiled Milk. I Promise.
SCP-4740 - As Davy wondered where they'd been, he read a book named Grass and Green.
SCP-4741 - Rolling Them Bones
SCP-4742 - A Job Well Done
SCP-4743 - A Proud Product of Vandelay Industries
SCP-4744 - Stay Woke
SCP-4745 - Spooky Scary Snowman
SCP-4749 - Demoniacal Paper Towel Dispenser
SCP-4750 - The Little Tailor of Zanzibar
SCP-4751 - Bed Angel
SCP-4752 - Mountainous Economics
SCP-4753 - Mysterious Object at Dodge City
SCP-4754 - Dentistaurant
SCP-4755 - When We Are Omnipotent
SCP-4756 - A Reborn Man.
SCP-4757 - Trials of Valhalla
SCP-4758 - Old Letters
SCP-4759 - The Challenger of Donut Taxes
SCP-4760 - An Eye for an Eye
SCP-4761 - Lost in Yesterday
SCP-4764 - OKKULT X-PERIENCE OF WYRLDENDING PORPORTIONS
SCP-4765 - A Shattered Visage Lies
SCP-4766 - My Beautiful, Beautiful Son
SCP-4767 - Oh God, I Forgot I Had This Class and the Final Exam is Today
SCP-4768 - The Tall Tales of Ulysses B. Donkman
SCP-4769 - Physics Teacher
SCP-4770 - Crab Cakes
SCP-4771 - We Don't Deserve Dogs
SCP-4772 - Kurentovanje
SCP-4775 - The Absolute Gall
SCP-4776 - REAGANWEAPON.
SCP-4777 - Connolly Was There
SCP-4778 - All's Whale that ends Whale
SCP-4782 - Nemmie
SCP-4783 - The Human Capital Convention
SCP-4784 - Nature Abhors a Vacuum Tube
SCP-4785 - Infohazardous Cabinet
SCP-4786 - The Mouth that Hungers
SCP-4787 - The Things He Wished He'd Known
SCP-4788 - Cash Cow
SCP-4789 - Battle for Dreamland
SCP-4790 - Do not go gentle into that good night.
SCP-4791 - The Lady's Matchmaker
SCP-4792 - The Contingency
SCP-4793 - Stele
SCP-4794 - The Renegade from Gliese 581
SCP-4795 - Feathered F(r)iends
SCP-4796 - Sanctuary of the Sky Pineapples
SCP-4798 - An Introduction to Transgenic Poetry
SCP-4799 - Mariachi's Merchants

4800-4899

SCP-4801 - Ceto-vimutti: Deliverance From Suffering
SCP-4802 - Dirty Birdy
SCP-4803 - The Man Documenting
SCP-4805 - Utilitarian
SCP-4806 - Appels du Vide
SCP-4808 - Spontaneous Dog Manifestation
SCP-4809 - Peeping Doesn't Pay
SCP-4810 - Hunt Stupid Game, Win Stupid Prizes
SCP-4811 - Instant Mirror from the Factory
SCP-4813 - My only way out is to forget I ever need a way out.
SCP-4815 - Busted Oracle
SCP-4817 - Horseman Holiday Rentals in scenic King Louis XVI of France
SCP-4819 - Never Miss the Last Day of Summer
SCP-4820 - The Custom of the Sea
SCP-4821 - You Get What I Never Got
SCP-4822 - Love was Real to Me
SCP-4824 - The Prince of Sands
SCP-4825 - Like a lake lake, bake a bake cake.
SCP-4827 - Ghost Stories Around a Black Hole
SCP-4828 - The Big Book Of Achievable Spells, made easy
SCP-4831 - There Are Innocent People on Death Row
SCP-4832 - 📻 👌
SCP-4833 - The Syncope Symphony
SCP-4834 - That Picture Perfect Moment
SCP-4835 - Beef With Beef With Beef With Beef With Beef With Beef With Beef With Beef With Beef With Beef With Beef With Beef With Beef With Beef With Beef With Beef With Beef With Beef With Beef With Beef With Beef With Beef With Beef With Beef With Beef With Beef With Beef With Beef With Beef With Beef
SCP-4836 - I Love You Beary Much
SCP-4842 - The Disintegration Loops
SCP-4843 - Take It With Me When I Go
SCP-4844 - Last Man Standing
SCP-4845 - Great Food; No Atmosphere (OR: Tacos That Are Literally Out of This World)
SCP-4846 - Friendly Fossils
SCP-4847 - Akanastra
SCP-4848 - Cross of Iron
SCP-4849 - Liposlugtion 3: Die Lard With A Vengeance
SCP-4850 - Madness Leaks Through a Broken Seal
SCP-4851 - Artificial Selection
SCP-4852 - Site-19 Goes South For The Winter!
SCP-4854 - The "Real" Necronomicon and other Godawful Occult Manuscripts
SCP-4855 - Mind Like a Steel Trap
SCP-4856 - "Test Case One"
SCP-4857 - [DESIGNATION AVAILABLE]
SCP-4858 - But the Rock Cried Out, No Hiding Place
SCP-4859 - A Game We Play
SCP-4860 - Clown Building
SCP-4861 - 12/11/2030
SCP-4862 - RAGE
SCP-4863 - Sol n
SCP-4864 - Depravity and Indifference
SCP-4865 - Safe safes aren't always safe
SCP-4866 - 𝘔𝘶𝘳𝘥𝘦𝘳𝘦𝘳™, a product of Optimark Synthetic Personnel Solutions¹
SCP-4867 - Wyoming Territory, 1867-1870
SCP-4868 - Vendedor Pulpo de Pulpos Vestido En Purpura
SCP-4869 - Boltz From The Blue
SCP-4870 - Something's Wrong with Site-17
SCP-4871 - Mirror Image
SCP-4872 - Flashback Bug
SCP-4873 - This Town Ain't Big Enough
SCP-4874 - Friends With You
SCP-4875 - Crying Beneath the Desert, Or; Lorem Desertum
SCP-4877 - Good Airwaves
SCP-4878 - Six-Foot Soldiers
SCP-4879 - Art in the Time of Elitism
SCP-4884 - To Serve Great Man
SCP-4885 - Find Him
SCP-4886 - The Cop and the Countryside
SCP-4887 - Bloom!
SCP-4888 - The Sunrise Collective
SCP-4889 - An Easy Mark
SCP-4891 - A Great Pestilence
SCP-4892 - The Rotten God
SCP-4893 - Agapanthus²
SCP-4894 - TOOL FOR EVERY USE
SCP-4895 - George stood alone.
SCP-4896 - Corvid Knife
SCP-4897 - Just Pet The Damn Dog
SCP-4898 - Do You Have What It Takes
SCP-4899 - Blackbody

4900-4999

SCP-4900 - A Critique of Man
SCP-4901 - Remember Rudy Benson.
SCP-4903 - Eternity, Served Cold
SCP-4904 - Rapid-Disc-Movement Sleep
SCP-4905 - Intergalactic TechnoVikings and The Great Moon Wars
SCP-4906 - On the Sixth Month Gale
SCP-4907 - Poetry Gnomes
SCP-4909 - Octopus' Garden
SCP-4912 - With Great Power
SCP-4913 - 5-Star [REDACTED]
SCP-4914 - Gamer Against Weeds
SCP-4915 - One Star Containment
SCP-4917 - Law & Oneiroi
SCP-4918 - Bergentruckung
SCP-4919 - Belle Époque
SCP-4920 - Take the Train
SCP-4921 - Please STOP Reading!
SCP-4922 - The Rainbow Connection
SCP-4924 - Tunnel Revenant
SCP-4926 - Close Call Printing Press
SCP-4927 - Have a Nice Flight
SCP-4928 - The Wishing Well
SCP-4929 - Lake of Rage
SCP-4930 - Lennon/McCartney
SCP-4932 - Sadly, Nothing Lasts Forever
SCP-4933 - We Interrupt This Broadcast
SCP-4936 - Summer Vacation 🦀
SCP-4937 - A Deflated Balloon Dog
SCP-4938 - Sweat of the Sun
SCP-4939 - The Man on the Moon
SCP-4940 - Transformer Transformer
SCP-4942 - How to Summon a Lemon
SCP-4943 - Transcendence
SCP-4944 - A Coffee Machine, Except It's Literally Just A Cargo Ship
SCP-4945 - Hi Hungry, I'm Dad
SCP-4947 - The Fault and the Fistula
SCP-4951 - South-Central Protective Services' new Containment Insurance Entity
SCP-4952 - PlayerUnknown's Robert Frost
SCP-4953 - Burger King Himself
SCP-4954 - Long Live the Tinsmith!
SCP-4956 - Screaming At The Void
SCP-4957 - Cold, Turning Blue
SCP-4958 - You Are Loved
SCP-4959 - Teotihuacan Pterodactylactery
SCP-4961 - All Dogs Go To Heaven
SCP-4962 - dack hunt REMIST ER
SCP-4963 - Static
SCP-4964 - A Bootleg DVD of The Shaggy Dog
SCP-4965 - My name is Legion for we are many
SCP-4966 - Tubbioca: Devourer of Souls, Consumer of Secrets, Lord of Munchies
SCP-4968 - Deer-mestic Terrorists
SCP-4969 - Literally Jellyfish Condoms
SCP-4970 - Universal Tech Support
SCP-4973 - Dead Men Walking
SCP-4976 - The Humanity of the Moment
SCP-4977 - The lucidity of young William Kleiger
SCP-4978 - BROOK TOWN BEAT DOWN
SCP-4980 - Alexylva University War Dodo Olympics Team
SCP-4982 - Heavy lies the crown.
SCP-4983 - Welcome to Hales
SCP-4984 - Mycelium memoriae
SCP-4985 - High Finance
SCP-4986 - From a Friend
SCP-4987 - Now Face North
SCP-4988 - Outsourced Customer Service Contact Center Solutions by Avelar Professional Products, Inc.
SCP-4989 - The Siege of Site 89
SCP-4990 - Queen-Sized Bed
SCP-4992 - Onions Make Me Cry
SCP-4993 - A Child's Mind Is A Wonderful Thing
SCP-4994 - An Ideal Foundation
SCP-4995 - Übermensch
SCP-4996 - The Demon, The Deal, and The Trashcan Elvis
SCP-4997 - Cauldros
SCP-4998 - Space Available, Inquire Within

Фрагмент списка для редактирования

Содержание
Корейский филиал
Китайский филиал
Французский филиал
Польский филиал
Испанский филиал
Тайский филиал
Японский филиал
Немецкий филиал
Итальянский филиал
Украинский филиал
Португальский филиал
Чешский филиал
Традиционный Китайский филиал
Вьетнамский филиал

Корейский филиал

Codename: scka - Defense mechanism
Codename: L.H. Sein - By people
SCP-002-KO - Xianess' fountain
SCP-003-KO - Farmhouse
SCP-004-KO - Eraser Phenomenon
SCP-005-KO - Mush-Room
SCP-006-KO - Killer Bed
SCP-010-KO - Honest Scam Calls
SCP-011-KO - The Sleeping Giant
SCP-014-KO - Ask Anything
SCP-021-KO - The sage's book
SCP-022-KO - The magnifying glass
SCP-033-KO - Print Foundation Documents With Caution
SCP-034-KO - Wolf Flower
SCP-048-KO - Science Club
SCP-049-KO - The Black Parade
SCP-050-KO - About SCP-050-KO
SCP-056-KO - ［ WARNING: DO NOT READ THIS PAGE! ］
SCP-064-KO - Seoul Cinematic Production
SCP-072-KO - Absolute Taste
SCP-077-KO - The Bermuda Triangle Underwear
SCP-079-KO - Containment-longing Shuttles
SCP-086-KO - Knives for Vegans
SCP-111-KO - A Small Error
SCP-112-KO - "Dog" Soju
SCP-113-KO - Eternal Thursday
SCP-114-KO - LED Fen Fire Flies
SCP-115-KO - "Meaningless" Regular Polyhedron
SCP-118-KO - The Savior of All
SCP-132-KO - Bawling Bamboo
SCP-137-KO - The Bad Land
SCP-149-KO - CC BY-NC-ND
SCP-153-KO - Read me before read below
SCP-154-KO - Read me before read above
SCP-157-KO - No time to go to the toilet
SCP-159-KO - Peach Blossom Land
SCP-168-KO - Stir-fry?
SCP-169-KO - The Volition Wins The Day
SCP-171-KO - Forgotten Music
SCP-185-KO - Visual Novel
SCP-188-KO - Heart of the Earth
SCP-189-KO - Dark alleyway
SCP-212-KO - Rusty Spade
SCP-217-KO - USS Enterprise
SCP-222-KO - A Train in Flames
SCP-229-KO - Quadrennial
SCP-234-KO - Doing Dootie Duty
SCP-268-KO - STRUCTURE ERROR
SCP-299-KO - A Murder of Crows
SCP-310-KO - Foods From That Far Place
SCP-321-KO - Fade-in Virus
SCP-326-KO - Natural reality fixation
SCP-345-KO - The Space Hero
SCP-380-KO - Now the test begins.
SCP-412-KO - [DATA NOT EXPUNGED]
SCP-416-KO - There is an instrument buried under the oak tree.
SCP-432-KO - The Child Gifted With Immortality
SCP-444-KO - Avici
SCP-499-KO - The real "BGM"
SCP-500-KO - The only cure
SCP-503-KO - Normalcy Classification System
SCP-505-KO - The Schoolbag
SCP-521-KO - What is Seeing?
SCP-545-KO - The Non-Flying Dutchman
SCP-602-KO - I want to be myself for once
SCP-621-KO - I will live in ██
SCP-650-KO - The Duty to Stop All Sin and Unhappiness On This World
SCP-689-KO - Fangi
SCP-702-KO - Grownups Don't Know
SCP-709-KO - Dismembered Eternity
SCP-713-KO - Gods of the Flying House
SCP-750-KO - Revenant Soldier
SCP-755-KO - Learn all the technology and knowledge you want; there are Other Important Things
SCP-774-KO - Planet Indra
SCP-797-KO - Skyfall
SCP-809-KO - Along the thorny vines
SCP-817-KO - Flame of Love
SCP-819-KO - Open the Curtains, Lights on
SCP-824-KO - 22×6×10²³ drops of water
SCP-825-KO - Sokcho Tongkeun Mulhoe Restaurant
SCP-826-KO - Homo Sapiens
SCP-827-KO - It's Beginning to Smell a Lot Like Christmas Everywhere I Go
SCP-828-KO - A Door Locked from the Inside
SCP-829-KO - MAD man
SCP-830-KO - 's slippers
SCP-841-KO - Supervisor: Antimeme Expert Lee Hanseok
SCP-876-KO - Head Siren
SCP-877-KO - B████d B████s
SCP-890-KO - Here be We, the Consequence of Your Actions
SCP-897-KO - [ASMR] Dentistry / Teeth Extraction Relaxing Sound
SCP-903-KO - Not Steroids!
SCP-916-KO - Perfectly Replaces the Biological Patriarch
SCP-923-KO - The Anti-Disney Department
SCP-953-KO - Pretending Humanoid
SCP-973-KO - Man With Gun
SCP-980-KO - Cloudy with a Chance of People
SCP-997-KO - The Edge of Esotery
SCP-516-KO-EX - [DATA REDUCED]
SCP-7891-KO-EX - Amnestic Mushroom
SCP-001-EX-KO-J - A Bad Boy
SCP-1004-KO-J - Girls' Magic Wand
SCP-none-KO-J - It's an annoying clothes hanger!

Китайский филиал

CODE NAME: Darkequation - Bamboo Scroll
CODE NAME: Anglia - Dragon Vein
CODE NAME: Veleafer - 演绎部
CODE NAME: Re_spectators - Substitution Reaction
SCP-CN-009 - Question, Solve, Answer
SCP-CN-010 - Aye-aye
SCP-CN-026 - No Longer be Alone
SCP-CN-048 - A Failed Attempt
SCP-CN-066 - OMG! What the Foundation Has Failed to Do for 20 Years Was Done by SCP-CN-066 in Just 4 Seconds…
SCP-CN-096 - "Stop" "Door"
SCP-CN-111 - The Solitary Venerable One
SCP-CN-114 - Pine of Awakening Smoke
SCP-CN-121 - The Badge of Dr. Sun Yat-sen
SCP-CN-, 00122 - Fifthist Memetics
SCP-CN-145 - Hometown
SCP-CN-161 - Interpreter
SCP-CN-166 - Embryos
SCP-CN-171 - Dormitory Manager
SCP-CN-176 - Uncle Sweets
SCP-CN-180 - SPEEDCORE GENERATOR!!!
SCP-CN-204 - Thunder Trial
SCP-CN-233 - Dot Matrix
丂匚卩句丹丂卄匚几句丹丂卄丅山口几丨几乇丂丨乂 - 卄丹几乙丨从乇从乇
SCP-CN-312 - What Does She Know?
SCP-CN-326 - ~~In Fading Books~~ A Digital Music Fantasy Is Reborn
SCP-CN-366 - Exist
SCP-CN-369 - Self-Declaration Rostrum
SCP-CN-404- Memetic Immunity Disease
SCP-CN-412- Beauty Camera
SCP-CN-440- Immortals of the Table
SCP-CN-444 - Heavenly Sounds
SCP-CN-445 - A Failed Anomalous Document
SCP-CN-475 - Entombing
SCP-CN-514 - Insomnia
SCP-CN-529 - No Longer Human
SCP-CN-534 - Mr. Dialect
SCP-CN-546 - Our Secrets
SCP-CN-661 - Dick, St. Dick
SCP-CN-666 - Hold the Bottom Line
SCP-CN-673 - A bunch of statues what move when you dun look at dem
SCP-CN-675 - The Great Kyet Khaewt Device
SCP-CN-678 - Stranger
SCP-CN-713 - Keyboard Fish
SCP-CN-717 - Throat Forest
SCP-CN-731 - Black Sunset
SCP-CN-756 - Book of Numbers
SCP-CN-757 - Tiny World
SCP-CN-758 - Mini-Foundation
SCP-CN-767 - Chart Syndrome
SCP-CN-797 - The Wandering Train
SCP-CN-805 - Magic: The Gathering
SCP-CN-810 - "Gold Foil"
SCP-CN-829 - Spherical Potatoes
SCP-CN-844 - The Seed of Lovesickness
SCP-CN-861 - The pedestrian in a painting
SCP-CN-879 - Programmable Office Building
SCP-CN-918 - ~~Ever-Drifting~~ Paper Plane
SCP-CN-937-J - A Useful Toilet
SCP-CN-964 - I'll turn on the Bluetooth and listen to some tunes
SCP-CN-985 - Exam Shark
SCP-CN-999 - Spreading Your Wings
SCP-CN-1000 - 2300
SCP-CN-1001 - Writing Ends Here
SCP-CN-1050 - "Aquarius"
SCP-CN-1076 - "Have another bottle"
SCP-CN-1080 - A Silent Bell
SCP-CN-1099 - ~~Tin of Sardines~~
SCP-CN-1123 - CTTGGGAGATGAATAGATGGGTTGCAACCCATCTATT……
SCP-CN-1138 - Anime Must Be Destroyed
SCP-CN-1145 - A Nonexistent Elevator
SCP-CN-1174 - Royal Quiet Deluxe Typewriter
SCP-CN-1256 - SCP Foundation Chinese Branch Chronicle
SCP-CN-1260 - Origin of Species, or Machinery of Creation
SCP-CN-1276 - "Zekkōchō Conveyor Belt Sushi Restaurant!"
SCP-CN-1391 - hamster pill by dado
SCP-CN-1409 - 4200006200
Work Notes: SCP-CN-1417
SCP-CN-1424 - not spicy mouthwash by dado
SCP-CN-1463 - Catgirl Training Plan
SCP-CN-1483 - Those distant, cold stones
SCP-CN-1500 - pʰoʃma
SCP-CN-1537 - Storytelling
SCP-CN-1604 - A Gun That Gets More Powerful As It Kills More People
SCP-CN-1621 - become cat pill by dado
SCP-CN-1666 - Veilbreak
SCP-CN-1691 - A machine looking for loved ones
SCP-CN-1733 - The Empty Patches of Sky
SCP-CN-1767 - What is Papa's Mama Called?
SCP-CN-1780 - Red Light, Green Light
SCP-CN-1831 - Human-repelling Incense
SCP-CN-1835 - The day the music died. Except for you.
SCP-CN-1837 - USB Sword
SCP-CN-1920 - J-Q-X, three brothers, see fish eyes and dig them out
SCP-CN-1976 - Little Red Book
SCP-CN-1987 - Plunger
SCP-CN-1997 - When Magic and Science Intersect
SCP-CN-2019 - Forbidden Borderline Θ
SCP-CN-2035 - Terminal Entertainment!
Riddle-2109: God
SCP-CN-2176 - Zero-Calorie Biscuits
SCP-CN-2200 - Hyper Dimension Action
SCP-CN-2215 - A Literary Opinion
SCP-CN-2227 - Drunk Alone
SCP-CN-2270 - Rainbow Mount
SCP-CN-2300 - 1000
SCP-CN-2304 - The Sun is Tired of Rising
SCP-CN-2345 - Memory-Carrying Enoki
Observation File #CN-2380 - When Spring Comes
SCP-CN-2399 - Still Raining
SCP-CN-2401 - Sick Hall
SCP-CN-2402 - The Star Nearby
SCP-CN-2403 - Dodgeball
SCP-CN-2405 - Ronald McDonald
SCP-CN-2406 - … would much rather have KFC!
SCP-CN-2426 - McNugget Fundamentalism
SCP-CN-2440 - A video of torturing tubers
SCP-CN-2517 - A Man Who Can~~not~~, In Fact, Fly
SCP-CN-2620 - Birthday
SCP-CN-2626 - D4C
SCP-CN-2631 - Aliens Speaking English
SCP-CN-2636 - MTF-己申-20 ("We")
SCP-CN-2740 - ~~Addictive Minecraft, Sentient NPCs~~, Digital Lies, Longing for Reality
SCP-CN-2752 - I See the Machine Core Before the Mechanical Revolution
SCP-CN-2781 - Before Sleeping
SCP-CN-2806 - Slickness
SCP-CN-2835 - Where am I?
SCP-CN-2878 - Very Annoying Mosquitoes
SCP-CN-2879 - Very Big Strainer
SCP-CN-2880 - Very Sharp Sword
SCP-CN-2918 - The Pleasant Sound of Rain
SCP-CN-2926 - Big Prime Number
SCP-CN-2980 - Your Copper Sulfate Friend
SCP-CN-2987 - Don't Look Up
SCP-CN-2989 - DEMONSTRATION OF THE PRECENCE
SCP-CN-2991 - Why disbelieve ye in the revelations of Anormaly, when ye bear witness
SCP-CN-116-EX - A Dazzling, Lively Relic
SCP-CN-3300-EX - The Lamb has Died
SCP-CN-123-J - How Many Urinals Do We Need?
SCP-CN-213-J - The Magical Geoduck
SCP-CN-404½-J - "The Foundation is FAKE!"
SCP-CN-421-J - The Great Radish
SCP-CN-555-J - Hurts Like Hell!
SCP-CN-666-J - Mew Mew Mew
SCP-CN-963-J - Extremely Annoying Codes
SCP-CN-1616-J - WTF YOU SAID YOU DIDNT REVIEW
SCP-CN-2000-J - Foundation's Bizarre Black-Technologies
SCP-CN-2719-J - "Waifu"

Французский филиал

CODE NAME: Dr. Gray - Not all angels have wings
CODE NAME: Dr. Johannes - Program Xibalba
SCP-014-FR - Agent of Chaos
SCP-021-FR - Lights of the Cliffs
SCP-027-FR - "Get Rick Rolled"
SCP-031-FR - The Knowledge-Eaters
SCP-043-FR - Blind Wanderer
SCP-045-FR - Thieving Arthropod
SCP-059-FR - Blizzard's Claws
SCP-060-FR - The Lich
SCP-061-FR - The Kiwi
SCP-073-FR - Biological Sterilizer
SCP-089-FR - The Athena Project
SCP-095-FR - The Demon Core
SCP-113-FR - ~~Infected file~~ S.O.S. - Dr. Anton Vehan
SCP-116-FR - Trabant 601 S "Hermes"
SCP-125-FR - Mark IV
SCP-137-FR - The One True Religion
SCP-143-FR - Mesozoic chicken coop
SCP-150-FR - Vox
SCP-155-FR - Wake up
SCP-161-FR - The Book And The Beast
SCP-164-FR - Creationism
SCP-172-FR - "Points of View"
SCP-181-FR - Non-recyclable
SCP-185-FR - Kinetic Inverter
SCP-192-FR - Your question
SCP-197-FR - Gardener Tortoises
SCP-198-FR - Considerations on the Causes of the Greatness of Mankind and its Decline
SCP-201-FR - Mind Palace Syndrome
SCP-213-FR - The Vagabonds of the Dark Forest
SCP-215-FR - Industrial Sardine
SCP-218-FR - The Antiquity Manufacturer
SCP-227-FR - Horoscomaton®
SCP-233-FR - The Pillow That Makes You Sleep
SCP-237-FR - Absurd Instability
SCP-281-FR - The Day The Earth Stopped Being Flat
SCP-291-FR - Containment Procedures Updated
SCP-296-FR - Dusk on Mars
SCP-299-FR - 113-B
SCP-320-FR - Life is a pillow
SCP-324-FR - He Died Thrice
SCP-327-FR - Foresight Cameras
SCP-335-FR - Lacrymodjinn
SCP-347-FR - Risky Driving
SCP-361-FR - Matriarch
SCP-375-FR - Proof of the existence and uniqueness of the Self
SCP-400-FR - She's Too Beautiful to be True
SCP-403-FR - Güiro in Exile
SCP-418-FR - Maurice the Concept-Eating sheep
SCP-445-FR - Monkey See, Monkey Shoot
SCP-466-FR - The Cottage Pottage
SCP-471-FR - Riders on the Storm
SCP-476-FR - Molecular Voodoo Dolls
SCP-484-FR - Billy the Euc-kid
SCP-503-FR - An Imperfect Allegory
SCP-505-FR - Before Aleph
SCP-510-FR - 5 Stars
SCP-540-FR - The Grass is greener
SCP-555-FR - The SCP Religion
SCP-569-FR - Dimensional gloryhole
SCP-589-FR - The Lamppost Song
SCP-192-FR-J - Chicken that runs like really really fast
FCP-676-FR-Vay - Exftremely Danverouf Viruf
SCP-1054-FR-J - Schisms

Польский филиал

CODE NAME: ZeroStrider — Wingless Birds
SCP-PL-007 - Happily nonexistent object
SCP-PL-023 - Written World
SCP-PL-030 - The Mulch
SCP-PL-037 - The Haunter
SCP-PL-052 - Subtemporal bracer
SCP-PL-057 - Leccinum Disappearing
SCP-PL-066 - Trapdoor in a storeroom
SCP-PL-067 - Dog that traveled in time
SCP-PL-078 - Earrings of Instant Meetup
SCP-PL-086 - I know about the Foundation
SCP-PL-091 - Calcumuttons
SCP-PL-144 - Analogue Virtual Reality
SCP-PL-149 - The Cinema
SCP-PL-150 - On vacations
SCP-PL-152 - Pet snakes
SCP-PL-160 - Fat Burner
SCP-PL-166 - Cemetery lights
SCP-PL-173 - Fungal sounds
SCP-PL-174 - R'EALITYBLENDER™
SCP-PL-180 - Those who embark with us
SCP-PL-183 - Lust of Speed
SCP-PL-186 - Art is Death
SCP-PL-195 - Gift from a friend
SCP-PL-200 - Responsible Reading
SCP-PL-203 - Weather for 2033
SCP-PL-204 - How to Disappear Completely and Never Be Found
SCP-PL-213 - Gloria Necatis
SCP-PL-231 - The Wrath of Perun
SCP-PL-248 - Heraclitic Tears
SCP-PL-253 - WHAT IN THE KENTUCKY FRIED FUCK
SCP-PL-259 - The list of territories conquered by Genghis Khan is incomplete, you can help by expanding it
SCP-PL-260 - We know where you live
SCP-PL-262 - A
SCP-PL-267 - Mieszko, Mieszko, mój koleżko
SCP-PL-284 - Oh God, oh fuck
SCP-PL-289 - A Multidimensional Solution For Shopping at Biedronka
SCP-PL-290 - Empiricism
SCP-PL-121-J - Diego the Turtle
SCP-PL-2004-J - The very fast vehicle of anthropomorphic amphibian
SCP-PL-2021-J - The hope for our world
SCP-PL-6470-J - Cat meme [DANGEROUS]

Испанский филиал

CODE NAME: Uncle Nicolini - The Nexus of Babel
SCP-ES-038 - The Bussinesman
SCP-ES-039 - Satellipeople
SCP-ES-040 - Polaris Leporidae
SCP-ES-044 - Necrofauna Arthropoda
SCP-ES-048 - The Power of Ideas
SCP-ES-054 - The Garden Gnome Gardeners
SCP-ES-058 - Stilhed Overalt; Silence Everywhere
SCP-ES-059 - Thirteen Little Fingers
SCP-ES-069 - The Twine upon the Fate of her Appeal to Look
SCP-ES-070 - Narcissus and the Plain of the Arrows of Eros
SCP-ES-076 - https://www.youtube.com/watch?v=fgm14D1jHUw
SCP-ES-081 - Gluttony
SCP-ES-083 - deCipher'em All v1.6
SCP-ES-087 - Sandbox; Intentional Continental Drift; I don't know biology so I'll turn fish into birds.
SCP-ES-089 - The Last Emperor of Hoiohiña
SCP-ES-090 - Nine Lights Emissary
SCP-ES-091 - Eugenics Nightmare
SCP-ES-095 - A Victimless Crime
SCP-ES-096 - THE GALLEON, or; Hunt the Dutchman! Or; The Assfuckedship
SCP-ES-097 - Fungi Reactor
SCP-ES-098 - Kynodontos
SCP-ES-099 - The Piano Concert
SCP-ES-100 - For Your Safety, Please Use the Stairs
SCP-ES-101 - Ye Shall Not Worship False Gods
SCP-ES-102 - The Cage
SCP-ES-103 - Frustrated Musician
SCP-ES-105 - Stargazing The Other Stars
SCP-ES-107 - Partnercaller3000
SCP-ES-111 - An explorer fallen from somewhere else
SCP-ES-112 - 🤑🔫 pay 2 win 🔫🤑
SCP-ES-113 - Special Deal
SCP-ES-115 - This is the Metro of Franco's Spain
SCP-ES-116 - A Gossiper Gramophone
SCP-ES-117 - A second chance
SCP-ES-119 - The Ministry of Abnormalities of Cuba
SCP-ES-120 - This Sickness Will Not Defeat Me
SCP-ES-122 - greatGreenishGreenery v1.01
SCP-ES-123 - Aurus Trading Company
SCP-ES-125 - North Korean Orbital Bombardment System
SCP-ES-132 - The Wall; The Selective; The Thing That Kills You; We Don't Let Fools In; The Witch Burning; The Booby Trap; Stress; These Fools Don't Learn; We Have The Key; The Key; I Need Sleep; Sometimes, A Break; Sometimes, A Life; Merlín
SCP-ES-133 - The Green One always finds its way
SCP-ES-136 - Penitent Cry
SCP-ES-137 - Sadness
SCP-ES-142 - The Bones of the Saints
SCP-ES-143 - May the Light of St. George lead us to Victory
SCP-ES-145 - Funerary Licentiousness
SCP-ES-146 - Who am I?
SCP-ES-147 - Cessation of Legacy
SCP-ES-152 - The Fall of the Fools
SCP-ES-157 - Coppélia
SCP-ES-158 - And the Potatoes Took Over the Earth
SCP-ES-163 - Elephant Graveyards
SCP-ES-165 - Kaiju Sarcophagus
SCP-ES-169 - The Hentai Dream Made True
SCP-ES-173 - The last sacrifice to Vulcan
SCP-ES-178 - The best re-union you will never have.
SCP-ES-180 - It's not yours, it's ours
SCP-ES-181 - The King Who Burnt
SCP-ES-184 - Vitrified Fortresses
SCP-ES-185 - Space Swallow
SCP-ES-186 - Absolute Corruption of Power
SCP-ES-191 - Stellar Garden
SCP-ES-193 - On the 13th of April, 2013, a Train Fell From the Sky
SCP-ES-194 - That motherfucker Fidel Castro just won't stay dead!
SCP-ES-196 - Buried Dreamers
SCP-ES-199 - Institution for Dealing with Your Issues of Normalcy
SCP-ES-200 - Mind Control Ball Cactus
SCP-ES-201 - Theatrum Mundi
SCP-ES-202 - What is HANSARP?
SCP-ES-203 - Super Golden Fruit
SCP-ES-208 - Flying Pigs
SCP-ES-216 - Lutiya, Pillar of Silence
SCP-ES-220 - Burning Soul
SCP-ES-230 - EAGLE Protocol
SCP-ES-232 - Gramophone Gal (Do You Like Gramophones?)
SCP-ES-234 - Detective Marw, Private Eye
SCP-ES-245 - Autarchy of Atonement
SCP-ES-250 - First Parca: Sons of the Harvest
SCP-ES-251 - Second Parca: Tales of Misery
SCP-ES-252 - Third Grim Reaper: The Life of Death
SCP-ES-256 - At midnight
SCP-ES-260 - The Blue Eyes of Gea
SCP-ES-261 - The taste of the stars and the desolation of Juno
SCP-ES-262 - RAVEYARD
SCP-ES-264 - A Friendly Crab
SCP-ES-266 - Scavenger Jellyfish
SCP-ES-268 - Electromagnet-shrooms
SCP-ES-284 - A, last? regret
SCP-ES-288 - Who is that walking beside you?
SCP-ES-290 - Wrong Taxi
SCP-ES-296 - The Path From Which We Come From
SCP-ES-297 - 🌮🔔
SCP-ES-100-EX - Mother Nature
SCP-ES-112 Extended Testing Log
Document-ES-061-B
SCP-RU-178 - The Heroes Of Vólorovsk
Proposal by Nico, Who Has Gone A Little Crazy
SCP-ES-I don't care-J - I don't care
SCP-ES-050-h2o-J - Bears are better than crocodiles. Probably.
SCP-ES-101-J - The Hard-To-Open Container
Emily Miranda Sends Nudes

Тайский филиал

CODE NAME: DrSSS - Another World Comers
SCP-009-TH - Human Anatomy Model
SCP-043-TH - Human Ice Cream
SCP-072-TH - The Castle Guards
SCP-400-TH - The Elephant is a Blood-thirsty Animal
SCP-412-TH - The Lattice (The Hydrologic Cycle)
SCP-747-TH - The Black Box
SCP-901-TH - The Giant Head
SCP-903-TH - Very Huge Dinosaur
SCP-025-TH-J - Stop for Inspection Sign
SCP-222-TH-J - ~~The Troll Cat~~ The Genius Hacker Cat

Японский филиал

CODE NAME: solvex - Acquittal and Miniascape
CODE NAME: amamiel - Ave Maria
CODE NAME: indonootoko - Arahitogami
CODE NAME: k-cal - ~~The Balance Scales~~ The Handover Report You Want
SCP-010-JP - "Mirai PC"
SCP-017-JP - Local Rules
SCP-020-JP - Winged Human
SCP-023-JP - Shadow Railway Line
SCP-030-JP - Petroleum Devourers
SCP-043-JP - Seasoning that Makes Anything Edible
SCP-047-JP - "For the Greatest Music"
SCP-065-JP - ~~from today on i am the prime minister~~ All We Need Is Dominator
SCP-076-JP - Terror Overhead
SCP-082-JP - To the Desired Country
SCP-086-JP - Zombie Virus
SCP-088-JP - Babies Can Choose Their Moms and Dads to Be Born to
SCP-094-JP - Marine Man
SCP-095-JP - Satō Saitō
What is SCP-105-JP? I've investigated it in my own way!
SCP-115-JP - Nue
SCP-120-JP - The World's Most Valuable Jewel
SCP-132-JP - One Fish, Two Fish, Paper Fish, Silverfish
SCP-167-JP - Restaurant Seashore
SCP-181-JP - Effective Advertising
SCP-184-JP - Worn-Out Utility Pole
SCP-194-JP - Paradise Inside a Memory
SCP-199-JP - Another Audience
SCP-266-JP - A Town Without Anyone
SCP-268-JP - The Never-Ending Epic
SCP-272-JP - "Floora"
SCP-277-JP - Feigning Death Tank
SCP-333-JP - The Earthlings
SCP-359-JP - Penguin Mushroom
SCP-373-JP - Manufacturing Group
SCP-398-JP - Eternal Room 105
SCP-407-JP - A Tub
SCP-419-JP - An Alternate History of Easter Island
SCP-444-JP - █████[ACCESS UNAUTHORIZED]
SCP-475-JP - I Want to See Only Beautiful Things
SCP-496-JP - Warning: Electronic Protocol in force when viewing this document
SCP-522-JP - Airborne Baguette Concentration Measurement Station
SCP-534-JP - Get a Glass for Flea
SCP-546-JP - Sugar and Spice and All That's Nice
SCP-548-JP - Singing Rain Sounds
SCP-557-JP - Déjà Mort
SCP-558-JP - Bunch o' Chicks 'n' BIG MAMA
SCP-569-JP - Konpeight
SCP-571-JP - NIGIRI OF THE DEAD
SCP-583-JP - Darkness of the Remembrance
SCP-586-JP - Snow Globes Past the Sell-By Date
SCP-588-JP - Transdimensional Buttock Wall ~ A Karcist's Ass Sticking Out Into Our Universe ~
SCP-632-JP - Human Internal Ants
SCP-646-JP - A Retro-bender
SCP-654-JP - Matryoshka
SCP-656-JP - Human Repellant Plastic Bottles
SCP-671-JP - The Night of Electric Jellyfishes
SCP-682-JP - Tough Microbe
SCP-737-JP - Merciful Jewelry Workshop
SCP-747-JP - How To Boil Some Eggs In This Shifting Universe
SCP-751-JP - EVERYBODY,FUCK YOU
SCP-787-JP - How Those Vacuous Spines Got So Close To You
SCP-818-JP - How great-
SCP-828-JP - Launching Site
SCP-830-JP - Downfall of One Night Castle
SCP-831-JP - Lurking Summer
SCP-835-JP - ~~Xenophobia~~ Keteru Yamiko
SCP-838-JP - Urban Waves
SCP-903-JP - Mr. Kojirō feat. Joyful Dancers
SCP-905-JP - Freddie’s Special Flight Show
SCP-918-JP - That's Someone else's Lost Dreams
SCP-922-JP - Animal Relocation
SCP-926-JP - Oneiric Eternal Recurrence Of The Nightmare Beast
SCP-949-JP - Overrunning Bulldozer
SCP-981-JP - Wenkankanhoyaukamuy
SCP-1012-JP - Inversive Monotony
SCP-1020-JP - Feeding Bowl for Chucky
SCP-1044-JP - For Those Who Will Listen
SCP-1045-JP - Corrective Lenses
SCP-1078-JP - Less Guilt-Provoking Laboratory Organisms
SCP-1100-JP - CAPTCHA
SCP-1118-JP - Tokyo DisneySky
SCP-1134-JP - Explosive Nigiri Sushiblade
SCP-1139-JP - Electronic Diva
SCP-1201-JP - Lakebed Electronics Store
SCP-1242-JP - Abyssal Toilet Stall
SCP-1249-JP - People
SCP-1299-JP - They're All Alive
SCP-1300-JP - An Offering to S
SCP-1302-JP - Revolving.
SCP-1304-JP - The Day the Wild Thistle Fell
SCP-1305-JP - Infinite Monkey Would Never Abuse Drugs
SCP-1330-JP - Crackti
SCP-1332-JP - Mule at the Edge of the World
SCP-1334-JP - Towards the Beach
SCP-1357-JP - Kingfisher, Shining As Bright As Fire
SCP-1379-JP - annoying omnipotent
SCP-1405-JP - British White Silver Garden
SCP-1407-JP - Chicks could remember
SCP-1431-JP - I Really Wanna make them into Moss.min.js
SCP-1440-JP - と
SCP-1444-JP - Reenacting Proof for the Sake of Pleasure
SCP-1475-JP - Target North Carolina!
SCP-1494-JP - The Roadkill is Always Watching Over Us
SCP-1495-JP - The Bystander is Only Watching for All Time
SCP-1548-JP - You Offend My Eyes
SCP-1566-JP - When the Body Dies, the Mind Also Dies; and When the Mind Dies, the Body Is As Good As Dead
SCP-1576-JP - Hence the God Exists
SCP-1577-JP - The Cow Lay Down On The Grass Because It Was So Starving
SCP-1579-JP - A Man's Neighbor
SCP-1581-JP - Graveyard is Full of Balloons
SCP-1646-JP - Everything is in a Dream
SCP-1657-JP - Eyedrops From the 2↑↑↑↑2nd Floor
SCP-1673-JP - Moses and the Hot Springs
SCP-1677-JP - Space Jumper
SCP-1687-JP - With You, Someday/Eternally
SCP-1690-JP - Tān, or Ouroboros
SCP-1693-JP - Birth of the Prison
SCP-1709-JP - Katana of Poetic Justice
SCP-1710-JP - CHOPIN GODZILLA
SCP-1721-JP - Love-Doll Retriever
SCP-1732-JP - Toutei - Invitation
SCP-1748-JP - Someday Somewhere
SCP-1774-JP - Natural Apple
SCP-1783-JP - The Ship is Full of Rabbits
SCP-1792-JP - Guillotine Lemonade, Friendly Price 25¢
SCP-1803-JP - Perpetual Generator, or a Black Box
SCP-1810-JP - QR Bird
SCP-1828-JP - Foggy Forest
SCP-1841-JP - Don't Get Off Your Pedestal
SCP-1857-JP - Cherry Blossom of Permanence
SCP-1866-JP - A Job to Save the World
SCP-1868-JP - Freed Headless Feline Carcasses (they can't go anywhere in the first place, and the neighbors don't give them a shit)
SCP-1873-JP - Yoke of Flesh
SCP-1876-JP - Out of Mom
SCP-1934-JP - Shiba Inu on the Suspension Bridge
SCP-1936-JP - This Connection Has Been Severed by a Nightmare Collective
SCP-1944-JP - Unfortunate Flying Object
SCP-1977-JP - Death Got A Non-Aquaphobic Horse
SCP-1978-JP - Sailor Suit and Machine Gun
SCP-1988-JP - Heisei Convenience Store Myths
SCP-1995-JP - Ushi-Gozen
SCP-1998-JP - A Girl Who Changes Shape with Extreme Force and a Super Deranged YouTuber
SCP-2005-JP - Sword of Judgement, Bell of Forgiveness
SCP-2048-JP - An Ordinary Coin
SCP-2057-JP - Back to the Egg, Then It Hatches
SCP-2061-JP - Adventure Tale at Gyouseiya Department Store
SCP-2077-JP - Turing Shredder
SCP-2113-JP - And He Closed His Eyes
SCP-2152-JP - Tranquility, Anxiety, Drinking Down into the Darkness
SCP-2170-JP - Oneigal Upload
SCP-2188-JP - Light Fingers with a Ready Tongue
SCP-2200-JP - BBC
SCP-2203-JP - Reset
SCP-2211-JP - Foundation Department of Hell
SCP-2227-JP - Tell Me Stories
SCP-2233-JP - He Who Was Mourned By As Many People As Possible
SCP-2300-JP - Whether I Stay or Not, I May Never Go Anywhere
SCP-2351-JP - Virtue's Vengeance
SCP-2371-JP - Soytaurus
SCP-2403-JP - Invasive Species Throwing Dude
SCP-2422-JP - Language Kusōzu
SCP-2424-JP - Lincoln Century
SCP-2426-JP - Won't You Jump Out At Me From That Corner?
SCP-2429-JP - Pufferfish Eten
SCP-2433-JP - Wrongful Indulgence
SLOT UNALLOCATED - That Which Kills Me
SCP-2459-JP - It Must Be a Warm Place That Leads to Hell
SCP-2472-JP - Nyankoderoga
SCP-2476-JP - cat.exe (Modification Prohibited)
SCP-2493-JP - Broken Smile
SCP-2503-JP - Those Who Wait for Absolute Zero
SCP-2505-JP - Processed Quail
SCP-2507-JP - Jumpscaring Ghosts
SCP-2513-JP - At Least, Be the Foundation
SCP-2566-JP - RETURN PARADOX
SCP-2580-JP - The Great Death
SCP-2581-JP - Make Me Look Pretty☆
SCP-2601-JP - "Me, and Yayoi, and Miyuki, and…"
SCP-2613-JP - Fear Conditioner
SCP-2626-JP (SCP-262-IE) - Casadh an tSúgáinTangled Thread
SCP-2642-JP - Making "Project Arca"
SCP-2650-JP - Transfeuneral
SCP-2687-JP - Meaning of Life/Meaning of Death
SCP-2707-JP - Floral Tribute for Me
SCP-2733-JP - The Road To Hell Is Paved All Over With Good Intentions, Even Having Information Signs
SCP-2744-JP - てるてるネコちゃん
SCP-2755-JP - A Star at the Bottom of a Lake
SCP-2760-JP - Dazzling with gold
SCP-2784-JP - Someone is Talking About You Somewhere
SCP-2788-JP - Your nth Dead Grandma
SCP-2790-JP - Foundation Department of Retention
SCP-2833-JP - SKYWELLS: THE SECOND
SCP-2840-JP - The Room
SCP-2844-JP - Cognitive Dissonance
SCP-2851-JP - No Longer Red Needed
SCP-2855-JP - SKYWELLS: THE FIRST
SCP-2856-JP - My Hero
SCP-2880-JP (Unassigned Number)
SCP-2891-JP - Interstellar Retribution
SCP-2904-JP - How Many Pigs Have You Ever Murdered?
SCP-2920-JP - Strangulation Demon
SCP-2955-JP - Septette for the Dead CN-Aniki
SCP-2973-JP - The Man with the Most Powerful Abilities Ever
SCP-2975-JP - "Cuz When I'm Up Late, I Wanna Eat Somethin'"
SCP-2989-JP - The Star of My Wish Rises in the Clear Blue Sky
SCP-666-JP-J - The Ultimate Horrible Object
SCP-999-JP-J - The Tickle Master
SCP-Shrimp-JP-J - ＞ A saury ＜
SCP-K2-JP-J - Oh shit !!!
5Ç卩-譁?ｭ怜喧縺-JP-J - Untellable
SCP-014-JP-EX - I Just Wanted to See that Look on your Face

Немецкий филиал

SCP-009-DE - Cheap Gas
SCP-015-DE - Dr. Duck
SCP-017-DE - R.T.I. Grizzly A1
SCP-028-DE - Sonderkommando for the paranormal
SCP-030-DE - R.T.I. Hammer P1
SCP-031-DE - Isabelle
SCP-034-DE - Shower of dread
SCP-042-DE - Avoid Containment
SCP-045-DE - What are you searching for?
SCP-046-DE - Shuffling Corpse
SCP-051-DE - Mr. Soother
SCP-056-DE - R.T.I Sentinel
SCP-058-DE - Peaceful Zombies
SCP-066-DE - The little Spellbook
SCP-070-DE - Pink Colony
SCP-076-DE - Face-Swap App
SCP-083-DE - Badge of Physical Fitness
SCP-087-DE - Confused AI
SCP-089-DE - The Athena Project
SCP-090-DE - I‘m SCP!
SCP-091-DE - The Loving Doll
SCP-096-DE - A Cosmic Phenomenon
SCP-098-DE - Demon vs Machine
SCP-099-DE - Gasmen
SCP-100-DE - The gargoyle's misdeeds
SCP-101-DE - Eik, the Tree of Knowledge
SCP-117-DE - The News of the Day to Come
SCP-121-DE - Telepathic humanoid
SCP-122-DE - Frau Harlekina
SCP-124-DE - Don't notice me
SCP-125-DE - The Imprisoned Regent
SCP-131-DE - Real Estate Shark
SCP-136-DE - The boy who stops time.
SCP-137-DE - Ice Phoenix
SCP-140-DE - Morts volantes
SCP-148-DE - Blue Slime [Level 25]
SCP-149-DE - The Spirit of Ruin
SCP-150-DE - Die Verteidiger
SCP-173-DE - Hating Stones
SCP-177-DE - The Rungholt Shard
SCP-178-DE - Dreamlike Weather
SCP-179-DE - To the most Righteous
SCP-180-DE - A little cute Birthdaypenguin
SCP-184-DE - Arachnophilia
SCP-186-DE - The True Meaning of Christmas
SCP-187-DE - Mathilda
SCP-188-DE - B4 “Blitzgewitter”
SCP-190-DE - Thor, God of Kebab
SCP-192-DE - "Knowledge"
SCP-200-DE - Higher Mathematics
SCP-201-DE - Metal Dragon
SCP-204-DE - The Chest of Eternity
SCP-207-DE - The heart of Cupido
SCP-208-DE - St Caesarius Hospital
SCP-209-DE - The idiot box
SCP-226-DE - Knight Cuddle Steel
SCP-227-DE - Moo
SCP-234-DE - A Christmas miracle
SCP-236-DE - A cup of love
SCP-237-DE - Her heart and his soul
SCP-239-DE - USB Jird
SCP-248-DE - Omni fork
SCP-255-DE - The Perfect Mascot
SCP-257-DE - A butt ugly owl
SCP-260-DE - Ahead of her time
SCP-272-DE - Megalodon
SCP-281-DE - A pretty good hotel
SCP-292-DE - Sweet Easter
SCP-293-DE - Aliens, go home!
SCP-296-DE - In death we blossom
SCP-297-DE - Combustible Deep-Sleep
SCP-299-DE - What the Future Holds
SCP-004-DE-EX - Repulsive
SCP-015-DE-J - This is why the SCP Foundation hates Ducks and Geese
SCP-027-DE-J - The Big Bad Tap Hen
SCP-033-DE-J - Earworm
SCP-044-DE-J - This damn schnapps
SCP-(INSERTANYNUMBERHERE)-DE-J - The Trainee
The Things Dr Ore Is Not Allowed To Do At The German Branch Of The Foundation

Итальянский филиал

CODENAME: /GRAF - The Dragon Of Revelation
CODENAME: /ABAD - The Values Of The Fatherland
SCP-002-IT - The Voice of the Piave
SCP-010-IT - Parental Care
SCP-011-IT - The Zero Zone
SCP-012-IT - Waltz No. 2
SCP-013-IT - Sentient Tornado
SCP-015-IT - The Boogeyman
SCP-017-IT - Sentient USB Pendrive
SCP-018-IT - EMP Barn Owl
SCP-019-IT - E-15 Chimera
SCP-020-IT - Horse with Oratory Skills
SCP-021-IT - The Capitoline Wolf
SCP-022-IT - Legion
SCP-023-IT - Hounds of the Dictator
SCP-024-IT - Rebar ಉ
SCP-025-IT - Kangaroo Mother
SCP-029-IT - The Last Vestal
SCP-032-IT - Haruspex
SCP-035-IT - The Hammer
SCP-037-IT - Subtle Vibration
SCP-038-IT - Ocean Stones
SCP-039-IT - Cordless Telephone
SCP-041-IT - A Flat World
SCP-042-IT - The Answer
SCP-045-IT - The Hypogea of the Daunia
SCP-050-IT - The Galleass
SCP-054-IT - Microcosmos
SCP-055-IT - The Devourers
SCP-057-IT - Under the Sea
SCP-066-IT - Diabolus ex Machina
SCP-067-IT - The King of the Hill
SCP-068-IT - Kaliperia
SCP-070-IT - Forgotten Depths
SCP-071-IT - Ötzi's cloak
SCP-079-IT - Locus Amoenus
SCP-080-IT - Shattered Civilization
SCP-082-IT - The Helmet of Knowledge
SCP-100-IT - Carnem Levare
SCP-103-IT - Ciapapuer
SCP-105-IT - Anachronistic Hallucinogenic Excrements
SCP-149-IT - After the End of the Eternity
SCP-004-IT-ARC - Infinite Tuning Guitar
SCP-008-IT-ARC - The Hotel
SCP-014-IT-ARC - XXXIII (Before Rewrite)
SCP-001-IT-J - The “Dragon” Of Revelation
SCP-002-IT-J - The Doctor-Destroyer
SCP-610-IT-J - The Perfect Projectile
SCP-1900-IT-J - The Pirate Kingdom
SCP-F2Y-IT-J - The [EXPLICIT]
Italian Sites -J - The best Sites of the Italian Branch!

Украинский филиал

SCP-012-UA - The Library
SCP-035-UA - Tablet of Veles
SCP-038-UA - Alike to black holes
SCP-046-UA - Tasty flashbacks
SCP-049-UA - Apparently… God?..
SCP-054-UA - Pater noster Bandera
SCP-056-UA - Pit on the road
SCP-065-UA - Deliver Us From Evil
SCP-069-UA - Cast-iron charcoal iron
SCP-079-UA - No-Sides
SCP-081-UA - Vanka-Vstanka
SCP-095-UA - Crazy Bee
SCP-2014-UA-EX - SCP-2014-RU
SCP-692-UA-J - Connection cockup

Португальский филиал

CODINAME: Project Bulwark - by slashannemoo & Vintner
SCP-002-PT - Women's Magazine
SCP-003-PT - Silent Droplets
SCP-004-PT - The Soldier and the Bomb
SCP-006-PT - Freefalling Nightmare
SCP-008-PT - Man-Man
SCP-010-PT - Peppers
SCP-011-PT - Victoria stella
SCP-013-PT - Crazy Cyborg's Samba
SCP-014-PT - Improvised Appearances
SCP-015-PT - Electromagnetic Cannon
SCP-016-PT - The Holy Grail
SCP-018-PT - Unrecorded Man
SCP-019-PT - Porcelain Dish
SCP-021-PT - Crystal Theatre
SCP-022-PT - Lawyers = Fairies and Vice Versa
SCP-023-PT - Xeno's Paradox
SCP-024-PT - A Longtime Friend
SCP-025-PT - Portable Desert
SCP-026-PT - Sober Drunk
—————— - This Shouldn't Exist
SCP-030-PT - Cultural Heritage
SCP-031-PT - Pocket Imp
SCP-034-PT - Creator Magnifying Glass
SCP-035-PT - The Pigeon
SCP-038-PT - Floating Snake
SCP-040-PT - Ostium Theater
SCP-041-PT - A Weapon Among the Stars
SCP-042-PT - The ████ Opener
SCP-043-PT - The Player
SCP-046-PT - Read a Book, Write a Book
SCP-049-PT - <N0:.WH3RE>
SCP-050-PT - The Sack Man
SCP-055-PT - Adaptive Tactical Armour for Containment and Assault
SCP-057-PT - The Abandoned Hospital
SCP-065-PT - Hard-to-Kill Armadillo
SCP-078-PT - The Fog
SCP-079-PT - Schrödinger's Planet
SCP-088-PT - This Machine Kills Commies
SCP-089-PT - I Shall Deeply Love You
SCP-094-PT - Apamachi Identity Camouflage Device.
SCP-101-PT - Manor of Madness
SCP-106-PT - Sonic Flashlight
SCP-110-PT - A Very Convincing Story
SCP-118-PT - That Which Shares
SCP-119-PT - The Pompous Girl
SCP-122-PT - Factor XX
SCP-143-PT - Escape from the Rio-Niterói Bridge
SCP-150-PT - P███ G████´s Progressive Location Pen
SCP-166-PT - The Light of the Court
SCP-170-PT - [31/12/2025]: thank you.
SCP-172-PT - Mother-of-Gold
SCP-177-PT - Time Travelling Lottery
SCP-191-PT - Acre's UFO
SCP-195-PT - Special Gift for Naughty Workers
SCP-196-PT - Midas Gloves
SCP-199-PT - Spread the Word
SCP-033-PT-EX - Dream-Catcher
SCP-019-PT-J - The Big Ban Hammer
SCP-045-PT-J - Monsterwave
SCP-075-PT-J - Good Morning!
SCP-109-PT-J - The Foundation
SCP-005-PT-ARC - The Reason Why Dendrophobia Exists
SCP-012-PT-ARC - Socrates

Чешский филиал

SCP-017-CS - Absolute Justice
SCP-023-CS - Why can't he just leave me alone?
SCP-042-CS - Northern Devil
SCP-073-CS - The cousin of Winnie the Pooh
SCP-082-CS - Captive of a frequency
SCP-087-CS - Splendid Light
SCP-148-CS - Unfinished Business

Традиционный Китайский филиал

SCP-ZH-002 - Taiwanese Unicorn
SCP-ZH-003 - Extreme Religion
SCP-ZH-004 - Marslow’s Daughter
SCP-ZH-005 - If you haven't re-shared this article with ten friends, then…
SCP-ZH-006 - The real meaning of popcorn
SCP-ZH-037 - Tears from Hawksbill Sea Turtle
SCP-ZH-038 - The Faceless Model
SCP-ZH-041 - Dreams
SCP-ZH-048 - Sword & Sorcery and Tea & Magic Hands
SCP-ZH-060 - The Deer Road Tunnel
SCP-ZH-105 - The Unfilials
SCP-ZH-132 - The 007 Game That Kills You
SCP-ZH-178 - The Bird Mug
SCP-ZH-200 - Let's Tag
SCP-ZH-228 - Tsuipu, 1947
SCP-ZH-236 - Last Year Syndrome (Senioritis)
SCP-ZH-251 - Ruins In Third Floor
SCP-ZH-261 - Cuban Sugar
SCP-ZH-282 - The Gourmet
SCP-ZH-310 - Anomalous Protein Domain
SCP-ZH-446 - Became Bug
SCP-ZH-526 - I’m Just a Toaster
SCP-ZH-545 - I'm Not A Dinosaur
SCP-ZH-617 - The Brave One From the West
SCP-ZH-618 - Sun Pastry Lion
SCP-ZH-736 - You Can't Go Any Further
Mrs. Alicia
SCP-ZH-860 - dado's Hair/Have-fortune Drug
SCP-ZH-889 - Beyond This World
SCP-ZH-973 - As Your Hatred
SCP-ZH-2005-EX - Internet Celebrity
SCP-ZH-9288-EX - You are completely aware that you will never meet the person sitting next to you listening to your story ever again.
SCP-ZH-00l - SCP-ZH-001
SCP-ZH-60053-J - HONK

Вьетнамский филиал

SCP-002-VN - Funeral
SCP-006-VN - The Night Stars
SCP-012-VN - One Gains, What One Wishes
SCP-013-VN - Poisonous Milk
SCP-014-VN - Dream Crayons™
SCP-018-VN - The Two-Wheeled Hatred
SCP-024-VN - The Beginning of All
SCP-033-VN - Rubber Duck
SCP-036-VN - The Cube
SCP-040-VN - Those Black Words
SCP-096-VN - Where the Earth Meets the Tide
SCP-099-VN - The Waifu Heaven
SCP-100-VN-J - The True Omnipotent SCP
SCP-6789-VN-J - A Kettle-Class Loudspeaker

Структурные: публичный_черновик

версия страницы: 7, Последняя правка: 23 Авг. 2023, 15:28 (498 дней назад)

SCP Foundation

Russian Branch

Список доступных тегов